Incidental Mutation 'R5732:Slco2a1'
ID451498
Institutional Source Beutler Lab
Gene Symbol Slco2a1
Ensembl Gene ENSMUSG00000032548
Gene Namesolute carrier organic anion transporter family, member 2a1
SynonymsPgt, mPgt, 2310021C19Rik, Slc21a2
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5732 (G1)
Quality Score206
Status Not validated
Chromosome9
Chromosomal Location102988712-103096002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103050256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 116 (T116I)
Ref Sequence ENSEMBL: ENSMUSP00000140533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]
Predicted Effect probably damaging
Transcript: ENSMUST00000035148
AA Change: T116I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: T116I

DomainStartEndE-ValueType
Pfam:MFS_1 39 428 3.5e-22 PFAM
KAZAL 446 493 2.78e-2 SMART
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188664
AA Change: T116I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548
AA Change: T116I

DomainStartEndE-ValueType
Pfam:OATP 31 381 4.8e-135 PFAM
Pfam:MFS_1 39 413 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Slco2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slco2a1 APN 9 103079441 splice site probably benign
IGL01481:Slco2a1 APN 9 103070251 missense probably damaging 1.00
IGL01647:Slco2a1 APN 9 103070296 missense possibly damaging 0.57
IGL01885:Slco2a1 APN 9 103074430 missense probably damaging 1.00
IGL02150:Slco2a1 APN 9 103084818 missense probably damaging 1.00
IGL02508:Slco2a1 APN 9 103074416 missense probably benign
IGL02578:Slco2a1 APN 9 103046758 missense probably damaging 1.00
IGL02622:Slco2a1 APN 9 103076929 nonsense probably null
IGL02898:Slco2a1 APN 9 103079606 missense probably damaging 1.00
IGL03101:Slco2a1 APN 9 103077006 missense possibly damaging 0.69
PIT4431001:Slco2a1 UTSW 9 103050268 missense probably damaging 1.00
R0410:Slco2a1 UTSW 9 103073314 critical splice donor site probably null
R0831:Slco2a1 UTSW 9 103082334 missense probably damaging 0.99
R0885:Slco2a1 UTSW 9 103082383 missense probably damaging 0.98
R1975:Slco2a1 UTSW 9 103079454 nonsense probably null
R2095:Slco2a1 UTSW 9 103076968 missense probably benign 0.22
R4072:Slco2a1 UTSW 9 103068002 missense probably damaging 1.00
R4105:Slco2a1 UTSW 9 103067876 missense probably benign 0.01
R4105:Slco2a1 UTSW 9 103073250 missense probably damaging 1.00
R4804:Slco2a1 UTSW 9 103073184 missense probably damaging 1.00
R4881:Slco2a1 UTSW 9 103085832 missense possibly damaging 0.71
R5073:Slco2a1 UTSW 9 103046726 missense probably damaging 1.00
R5124:Slco2a1 UTSW 9 103050166 missense probably damaging 1.00
R5147:Slco2a1 UTSW 9 103050269 missense probably damaging 1.00
R5317:Slco2a1 UTSW 9 103079579 missense probably benign 0.01
R5363:Slco2a1 UTSW 9 103070263 missense probably damaging 0.99
R5381:Slco2a1 UTSW 9 103068014 missense probably damaging 1.00
R5736:Slco2a1 UTSW 9 103067830 missense probably benign 0.00
R5924:Slco2a1 UTSW 9 103046699 nonsense probably null
R5945:Slco2a1 UTSW 9 103046790 missense probably damaging 1.00
R6293:Slco2a1 UTSW 9 103050147 missense probably benign 0.30
R6386:Slco2a1 UTSW 9 103076988 missense probably benign
R6622:Slco2a1 UTSW 9 103074505 missense possibly damaging 0.84
R7325:Slco2a1 UTSW 9 103085749 splice site probably null
R7484:Slco2a1 UTSW 9 103067986 missense probably damaging 1.00
Z1088:Slco2a1 UTSW 9 103079527 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGCACTAAAGCCAGACGG -3'
(R):5'- AAGTCAAGGACAGTCTCTAGCG -3'

Sequencing Primer
(F):5'- CTCCCTAGGTGAGCTATGGTAG -3'
(R):5'- CAGTCTCTAGCGGGAGAGG -3'
Posted On2017-01-03