Mutagenetix > Incidental Mutation

Incidental Mutation 'R5732:Cdh23'

451501

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin related 23 (otocadherin)

Synonyms

bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181

MMRRC Submission

043347-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R5732 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60138527-60532269 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60167096 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1852 (V1852A)

Ref Sequence

ENSEMBL: ENSMUSP00000101102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000073242
AA Change: V1849A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: V1849A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105461
AA Change: V1850A

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: V1850A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105462
AA Change: V1852A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: V1852A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105463
AA Change: V1850A

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: V1850A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: V1848A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: V1848A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.8%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	T	A	9: 118,977,462 (GRCm39)	M407L	possibly damaging	Het
Acsf2	T	C	11: 94,460,768 (GRCm39)		probably benign	Het
Apob	A	G	12: 8,060,353 (GRCm39)	D2945G	probably benign	Het
Atg2a	T	C	19: 6,307,490 (GRCm39)	Y1475H	probably damaging	Het
Capn5	A	G	7: 97,778,593 (GRCm39)	L342P	possibly damaging	Het
Ccdc152	A	G	15: 3,321,860 (GRCm39)		probably null	Het
Ccdc7b	A	G	8: 129,799,195 (GRCm39)	M91V	possibly damaging	Het
Cd3g	T	C	9: 44,884,929 (GRCm39)	E105G	possibly damaging	Het
Cdadc1	A	G	14: 59,834,360 (GRCm39)	L44P	probably damaging	Het
Cdx2	T	C	5: 147,238,833 (GRCm39)	Q252R	possibly damaging	Het
Cps1	A	T	1: 67,196,923 (GRCm39)	I325F	probably benign	Het
Dctn1	G	A	6: 83,174,931 (GRCm39)		probably null	Het
Dcun1d3	T	C	7: 119,457,256 (GRCm39)	K152R	probably benign	Het
Dhx35	G	A	2: 158,673,705 (GRCm39)	V379M	probably damaging	Het
Fam171a2	T	C	11: 102,330,807 (GRCm39)	E224G	possibly damaging	Het
Flt1	G	T	5: 147,571,293 (GRCm39)	Y671*	probably null	Het
Fndc3b	T	C	3: 27,515,922 (GRCm39)	Y628C	probably damaging	Het
Foxj3	A	T	4: 119,443,008 (GRCm39)	D144V	probably damaging	Het
Gp2	A	G	7: 119,048,331 (GRCm39)	V429A	probably damaging	Het
Hydin	T	A	8: 111,178,690 (GRCm39)	I1095N	probably benign	Het
Kat2a	A	G	11: 100,599,066 (GRCm39)	F571S	probably damaging	Het
Kcnq1	C	A	7: 142,702,493 (GRCm39)		probably benign	Het
Letm2	A	C	8: 26,077,341 (GRCm39)	S250A	possibly damaging	Het
Llgl1	T	C	11: 60,600,286 (GRCm39)	V545A	probably benign	Het
Lrfn3	T	C	7: 30,059,031 (GRCm39)	D398G	probably benign	Het
Lrig1	G	T	6: 94,676,520 (GRCm39)	C49*	probably null	Het
Mug1	A	G	6: 121,855,452 (GRCm39)	I929V	probably benign	Het
Naaa	G	A	5: 92,411,314 (GRCm39)	T291I	probably damaging	Het
Ndufaf1	G	A	2: 119,490,521 (GRCm39)	Q180*	probably null	Het
Nr3c1	A	T	18: 39,548,752 (GRCm39)	H741Q	probably damaging	Het
Nsun5	T	C	5: 135,400,204 (GRCm39)	L109P	probably damaging	Het
Pacsin3	A	G	2: 91,090,605 (GRCm39)	E18G	probably damaging	Het
Rpgr	G	A	X: 10,032,511 (GRCm39)	P857L	probably benign	Het
Siglec1	G	A	2: 130,916,188 (GRCm39)	T1254M	probably benign	Het
Slc35a4	A	T	18: 36,815,394 (GRCm39)	T75S	probably benign	Het
Slc52a2	T	C	15: 76,425,274 (GRCm39)	I434T	probably benign	Het
Slco2a1	C	T	9: 102,927,455 (GRCm39)	T116I	probably damaging	Het
Snrpd2	T	C	7: 18,886,538 (GRCm39)		probably null	Het
Tbc1d32	T	A	10: 55,964,489 (GRCm39)	L903F	probably damaging	Het
Tex10	G	T	4: 48,460,046 (GRCm39)	T435K	probably damaging	Het
Tmem266	T	C	9: 55,288,120 (GRCm39)	S66P	probably damaging	Het
Top2b	A	T	14: 16,400,106 (GRCm38)	E581D	possibly damaging	Het
Uggt1	A	T	1: 36,200,852 (GRCm39)		probably null	Het
Wdr47	T	A	3: 108,540,472 (GRCm39)	Y622*	probably null	Het
Zfp644	A	T	5: 106,784,989 (GRCm39)	H519Q	probably damaging	Het
Zfp687	T	C	3: 94,918,528 (GRCm39)	M415V	possibly damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60,359,327 (GRCm39)	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60,256,920 (GRCm39)	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60,143,301 (GRCm39)	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60,301,876 (GRCm39)	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60,146,566 (GRCm39)	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60,220,848 (GRCm39)	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60,150,473 (GRCm39)	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60,244,926 (GRCm39)	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60,433,504 (GRCm39)	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60,167,612 (GRCm39)	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60,139,292 (GRCm39)	missense	probably benign
IGL01767:Cdh23	APN	10	60,151,503 (GRCm39)	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60,146,916 (GRCm39)	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60,255,598 (GRCm39)	splice site	probably null
IGL02025:Cdh23	APN	10	60,220,922 (GRCm39)	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60,359,339 (GRCm39)	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60,433,544 (GRCm39)	splice site	probably benign
IGL02175:Cdh23	APN	10	60,167,087 (GRCm39)	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60,140,903 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60,159,302 (GRCm39)	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60,301,322 (GRCm39)	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60,153,721 (GRCm39)	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60,220,958 (GRCm39)	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60,485,901 (GRCm39)	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60,301,774 (GRCm39)	splice site	probably benign
IGL02626:Cdh23	APN	10	60,227,580 (GRCm39)	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60,147,143 (GRCm39)	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60,212,593 (GRCm39)	missense	probably damaging	0.99
dee_dee	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
hersey	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60,150,399 (GRCm39)	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60,301,237 (GRCm39)	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60,248,952 (GRCm39)	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
R0172:Cdh23	UTSW	10	60,155,411 (GRCm39)	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60,152,838 (GRCm39)	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60,215,094 (GRCm39)	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60,246,576 (GRCm39)	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60,222,725 (GRCm39)	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60,152,375 (GRCm39)	splice site	probably benign
R0545:Cdh23	UTSW	10	60,167,070 (GRCm39)	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60,269,556 (GRCm39)	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60,159,153 (GRCm39)	nonsense	probably null
R0647:Cdh23	UTSW	10	60,143,681 (GRCm39)	missense	probably damaging	0.99
R0730:Cdh23	UTSW	10	60,159,493 (GRCm39)	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60,242,200 (GRCm39)	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60,246,639 (GRCm39)	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60,370,289 (GRCm39)	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60,167,572 (GRCm39)	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60,148,171 (GRCm39)	splice site	probably benign
R1449:Cdh23	UTSW	10	60,212,730 (GRCm39)	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60,322,899 (GRCm39)	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60,215,122 (GRCm39)	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60,150,110 (GRCm39)	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60,255,478 (GRCm39)	splice site	probably benign
R1704:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60,359,315 (GRCm39)	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60,161,855 (GRCm39)	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60,324,321 (GRCm39)	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60,227,505 (GRCm39)	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60,167,060 (GRCm39)	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60,159,076 (GRCm39)	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60,272,597 (GRCm39)	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60,159,349 (GRCm39)	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60,246,652 (GRCm39)	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60,221,001 (GRCm39)	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60,159,361 (GRCm39)	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60,150,006 (GRCm39)	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60,301,822 (GRCm39)	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60,432,509 (GRCm39)	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60,301,783 (GRCm39)	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60,159,224 (GRCm39)	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60,152,503 (GRCm39)	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60,143,275 (GRCm39)	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60,244,789 (GRCm39)	splice site	probably benign
R3424:Cdh23	UTSW	10	60,212,660 (GRCm39)	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60,246,601 (GRCm39)	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60,256,819 (GRCm39)	splice site	probably null
R4273:Cdh23	UTSW	10	60,146,940 (GRCm39)	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60,139,272 (GRCm39)	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60,220,838 (GRCm39)	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60,146,865 (GRCm39)	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60,370,202 (GRCm39)	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60,244,823 (GRCm39)	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60,173,445 (GRCm39)	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60,167,129 (GRCm39)	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60,244,856 (GRCm39)	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60,220,817 (GRCm39)	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60,255,556 (GRCm39)	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60,227,563 (GRCm39)	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60,212,713 (GRCm39)	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60,173,630 (GRCm39)	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60,143,714 (GRCm39)	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60,143,811 (GRCm39)	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60,140,627 (GRCm39)	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60,272,586 (GRCm39)	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60,148,061 (GRCm39)	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60,148,351 (GRCm39)	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60,493,044 (GRCm39)	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60,173,541 (GRCm39)	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60,150,090 (GRCm39)	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60,370,165 (GRCm39)	splice site	probably null
R5673:Cdh23	UTSW	10	60,143,636 (GRCm39)	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60,228,802 (GRCm39)	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60,243,259 (GRCm39)	missense	probably damaging	0.98
R5739:Cdh23	UTSW	10	60,141,388 (GRCm39)	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60,242,171 (GRCm39)	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60,141,907 (GRCm39)	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60,220,713 (GRCm39)	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60,264,158 (GRCm39)	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60,213,600 (GRCm39)	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60,228,763 (GRCm39)	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60,249,356 (GRCm39)	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60,143,761 (GRCm39)	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60,167,105 (GRCm39)	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60,301,321 (GRCm39)	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60,269,537 (GRCm39)	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60,270,291 (GRCm39)	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60,246,600 (GRCm39)	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60,262,451 (GRCm39)	nonsense	probably null
R6302:Cdh23	UTSW	10	60,140,872 (GRCm39)	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60,248,930 (GRCm39)	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60,274,626 (GRCm39)	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60,167,609 (GRCm39)	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60,141,947 (GRCm39)	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60,214,650 (GRCm39)	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60,141,901 (GRCm39)	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60,322,893 (GRCm39)	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60,274,635 (GRCm39)	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60,485,893 (GRCm39)	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60,173,085 (GRCm39)	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60,366,770 (GRCm39)	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60,222,823 (GRCm39)	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60,143,759 (GRCm39)	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60,148,378 (GRCm39)	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60,167,596 (GRCm39)	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60,212,620 (GRCm39)	missense	probably benign
R7335:Cdh23	UTSW	10	60,140,895 (GRCm39)	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60,366,775 (GRCm39)	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60,151,471 (GRCm39)	nonsense	probably null
R7374:Cdh23	UTSW	10	60,153,679 (GRCm39)	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60,142,003 (GRCm39)	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60,220,724 (GRCm39)	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60,159,329 (GRCm39)	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60,243,186 (GRCm39)	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60,140,931 (GRCm39)	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60,173,043 (GRCm39)	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60,148,356 (GRCm39)	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60,220,973 (GRCm39)	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60,149,979 (GRCm39)	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60,143,668 (GRCm39)	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60,218,485 (GRCm39)	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60,171,967 (GRCm39)	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60,432,518 (GRCm39)	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60,150,162 (GRCm39)	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60,173,472 (GRCm39)	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60,272,568 (GRCm39)	missense	probably damaging	1.00
R8317:Cdh23	UTSW	10	60,147,037 (GRCm39)	critical splice donor site	probably null
R8326:Cdh23	UTSW	10	60,274,591 (GRCm39)	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60,167,507 (GRCm39)	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60,160,799 (GRCm39)	missense	probably benign
R8504:Cdh23	UTSW	10	60,274,618 (GRCm39)	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60,147,114 (GRCm39)	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60,324,372 (GRCm39)	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60,244,877 (GRCm39)	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60,160,755 (GRCm39)	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60,212,613 (GRCm39)	nonsense	probably null
R8889:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60,140,908 (GRCm39)	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60,173,625 (GRCm39)	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60,140,277 (GRCm39)	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60,151,478 (GRCm39)	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60,218,303 (GRCm39)	intron	probably benign
R9070:Cdh23	UTSW	10	60,173,539 (GRCm39)	missense	probably benign
R9075:Cdh23	UTSW	10	60,153,541 (GRCm39)	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60,270,283 (GRCm39)	splice site	probably benign
R9155:Cdh23	UTSW	10	60,249,485 (GRCm39)	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60,161,810 (GRCm39)	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60,153,664 (GRCm39)	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60,243,210 (GRCm39)	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60,215,044 (GRCm39)	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60,249,442 (GRCm39)	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9352:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60,148,387 (GRCm39)	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60,166,995 (GRCm39)	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60,146,895 (GRCm39)	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60,214,574 (GRCm39)	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60,243,168 (GRCm39)	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60,167,135 (GRCm39)	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60,432,561 (GRCm39)	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60,220,913 (GRCm39)	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60,249,423 (GRCm39)	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60,264,100 (GRCm39)	missense	probably benign
Z1176:Cdh23	UTSW	10	60,146,549 (GRCm39)	missense	probably damaging	1.00
Z1177:Cdh23	UTSW	10	60,270,393 (GRCm39)	critical splice acceptor site	probably null
Z1177:Cdh23	UTSW	10	60,159,334 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CCTACCGTGGCATTGATGAAG -3'
(R):5'- GCTCAGGGGCTGGATATCTTTC -3'

Sequencing Primer
(F):5'- ATTGATGAAGAAGGCCCGCTCTC -3'
(R):5'- CTGGTTCAGACCTGTCGC -3'

Posted On

2017-01-03