Incidental Mutation 'R5732:Kat2a'
ID451503
Institutional Source Beutler Lab
Gene Symbol Kat2a
Ensembl Gene ENSMUSG00000020918
Gene NameK(lysine) acetyltransferase 2A
SynonymsGcn5, PCAF-B/GCN5, 1110051E14Rik, Gcn5l2
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100704746-100712465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100708240 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 571 (F571S)
Ref Sequence ENSEMBL: ENSMUSP00000099407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006973] [ENSMUST00000017974] [ENSMUST00000103118]
Predicted Effect probably damaging
Transcript: ENSMUST00000006973
AA Change: F570S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006973
Gene: ENSMUSG00000020918
AA Change: F570S

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 332 1.2e-155 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 538 621 5e-13 PFAM
Pfam:Acetyltransf_1 545 620 3.2e-11 PFAM
low complexity region 659 675 N/A INTRINSIC
BROMO 718 826 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017974
SMART Domains Protein: ENSMUSP00000017974
Gene: ENSMUSG00000017830

DomainStartEndE-ValueType
DEXDc 2 207 2.86e-22 SMART
HELICc 387 475 3.85e-14 SMART
Blast:HELICc 497 543 4e-12 BLAST
Pfam:RIG-I_C-RD 552 667 1.5e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103118
AA Change: F571S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099407
Gene: ENSMUSG00000020918
AA Change: F571S

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 331 4.4e-120 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 539 622 1.2e-11 PFAM
Pfam:Acetyltransf_1 547 621 3.1e-11 PFAM
low complexity region 660 676 N/A INTRINSIC
BROMO 719 827 6.87e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153526
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit poorly developed yolk sac blood vessels, retarded growth, absence of dorsal mesoderm lineages, failure to form somites, and lethality between embryonic days 9.5-11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Kat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00476:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00952:Kat2a APN 11 100706151 missense probably damaging 0.98
IGL01529:Kat2a APN 11 100711909 missense probably damaging 1.00
IGL02424:Kat2a APN 11 100711147 splice site probably null
IGL03338:Kat2a APN 11 100711475 missense probably benign 0.30
R0096:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0711:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0714:Kat2a UTSW 11 100711352 missense probably damaging 0.99
R0784:Kat2a UTSW 11 100710841 missense probably benign 0.05
R1652:Kat2a UTSW 11 100708611 missense probably damaging 0.98
R2152:Kat2a UTSW 11 100712346 unclassified probably benign
R2177:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R2510:Kat2a UTSW 11 100712142 missense probably benign 0.32
R2570:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R4175:Kat2a UTSW 11 100705266 missense probably damaging 1.00
R4965:Kat2a UTSW 11 100712203 unclassified probably benign
R4965:Kat2a UTSW 11 100712204 unclassified probably benign
R5316:Kat2a UTSW 11 100712170 missense possibly damaging 0.77
R5954:Kat2a UTSW 11 100708898 missense possibly damaging 0.89
R6618:Kat2a UTSW 11 100712370 unclassified probably benign
R6719:Kat2a UTSW 11 100712141 missense probably benign 0.00
R6731:Kat2a UTSW 11 100708273 missense probably damaging 0.98
R7291:Kat2a UTSW 11 100710900 missense possibly damaging 0.55
R7373:Kat2a UTSW 11 100708566 missense probably benign 0.00
R7632:Kat2a UTSW 11 100708596 nonsense probably null
R8305:Kat2a UTSW 11 100709478 missense possibly damaging 0.77
R8322:Kat2a UTSW 11 100712290 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATAAAGCTGCCACCCTG -3'
(R):5'- AACAGGGCTCCACCTTTCAG -3'

Sequencing Primer
(F):5'- CCTGTGGGAGTATGTGGAAATGTC -3'
(R):5'- GGGCTCCACCTTTCAGGGTTC -3'
Posted On2017-01-03