Mutagenetix > Incidental Mutations

Incidental Mutation 'R5732:Apob'

451506

Institutional Source

Beutler Lab

Gene Symbol

Apob

Ensembl Gene

ENSMUSG00000020609

Gene Name

apolipoprotein B

Synonyms

apob-100, apob-48

MMRRC Submission

043347-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.916) question?

Stock #

R5732 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7977648-8016835 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8010353 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2945 (D2945G)

Ref Sequence

ENSEMBL: ENSMUSP00000036044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]

Predicted Effect

probably benign
Transcript: ENSMUST00000037520
AA Change: D2912G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: D2912G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	33	585	6.03e-94	SMART
DUF1943	619	932	7.88e-97	SMART
Pfam:DUF1081	945	1059	9.4e-32	PFAM
low complexity region	1100	1109	N/A	INTRINSIC
Blast:LPD_N	1249	1311	9e-22	BLAST
low complexity region	1632	1644	N/A	INTRINSIC
internal_repeat_1	1882	2038	6.61e-9	PROSPERO
SCOP:d1gw5a_	2105	2577	9e-5	SMART
internal_repeat_1	2973	3150	6.61e-9	PROSPERO
low complexity region	3561	3580	N/A	INTRINSIC
low complexity region	3928	3936	N/A	INTRINSIC
Pfam:ApoB100_C	4401	4456	5.6e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000037811
AA Change: D2945G

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: D2945G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	46	598	6.03e-94	SMART
DUF1943	632	945	7.88e-97	SMART
Pfam:DUF1081	960	1070	6.3e-39	PFAM
low complexity region	1113	1122	N/A	INTRINSIC
Blast:LPD_N	1282	1344	1e-21	BLAST
low complexity region	1665	1677	N/A	INTRINSIC
internal_repeat_1	1915	2071	6.6e-9	PROSPERO
SCOP:d1gw5a_	2138	2610	9e-5	SMART
internal_repeat_1	3006	3183	6.6e-9	PROSPERO
low complexity region	3594	3613	N/A	INTRINSIC
low complexity region	3961	3969	N/A	INTRINSIC
Pfam:ApoB100_C	4434	4490	1.6e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171239

SMART Domains

Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

Domain	Start	End	E-Value	Type
low complexity region	348	356	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.8%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	T	A	9: 119,148,394	M407L	possibly damaging	Het
Acsf2	T	C	11: 94,569,942		probably benign	Het
Atg2a	T	C	19: 6,257,460	Y1475H	probably damaging	Het
Capn5	A	G	7: 98,129,386	L342P	possibly damaging	Het
Ccdc152	A	G	15: 3,292,378		probably null	Het
Ccdc7b	A	G	8: 129,072,714	M91V	possibly damaging	Het
Cd3g	T	C	9: 44,973,631	E105G	possibly damaging	Het
Cdadc1	A	G	14: 59,596,911	L44P	probably damaging	Het
Cdh23	A	G	10: 60,331,317	V1852A	possibly damaging	Het
Cdx2	T	C	5: 147,302,023	Q252R	possibly damaging	Het
Cps1	A	T	1: 67,157,764	I325F	probably benign	Het
Dctn1	G	A	6: 83,197,949		probably null	Het
Dcun1d3	T	C	7: 119,858,033	K152R	probably benign	Het
Dhx35	G	A	2: 158,831,785	V379M	probably damaging	Het
Fam171a2	T	C	11: 102,439,981	E224G	possibly damaging	Het
Flt1	G	T	5: 147,634,483	Y671*	probably null	Het
Fndc3b	T	C	3: 27,461,773	Y628C	probably damaging	Het
Foxj3	A	T	4: 119,585,811	D144V	probably damaging	Het
Gp2	A	G	7: 119,449,108	V429A	probably damaging	Het
Hydin	T	A	8: 110,452,058	I1095N	probably benign	Het
Kat2a	A	G	11: 100,708,240	F571S	probably damaging	Het
Kcnq1	C	A	7: 143,148,756		probably benign	Het
Letm2	A	C	8: 25,587,325	S250A	possibly damaging	Het
Llgl1	T	C	11: 60,709,460	V545A	probably benign	Het
Lrfn3	T	C	7: 30,359,606	D398G	probably benign	Het
Lrig1	G	T	6: 94,699,539	C49*	probably null	Het
Mug1	A	G	6: 121,878,493	I929V	probably benign	Het
Naaa	G	A	5: 92,263,455	T291I	probably damaging	Het
Ndufaf1	G	A	2: 119,660,040	Q180*	probably null	Het
Nr3c1	A	T	18: 39,415,699	H741Q	probably damaging	Het
Nsun5	T	C	5: 135,371,350	L109P	probably damaging	Het
Pacsin3	A	G	2: 91,260,260	E18G	probably damaging	Het
Rpgr	G	A	X: 10,166,272	P857L	probably benign	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Slc35a4	A	T	18: 36,682,341	T75S	probably benign	Het
Slc52a2	T	C	15: 76,541,074	I434T	probably benign	Het
Slco2a1	C	T	9: 103,050,256	T116I	probably damaging	Het
Snrpd2	T	C	7: 19,152,613		probably null	Het
Tbc1d32	T	A	10: 56,088,393	L903F	probably damaging	Het
Tex10	G	T	4: 48,460,046	T435K	probably damaging	Het
Tmem266	T	C	9: 55,380,836	S66P	probably damaging	Het
Top2b	A	T	14: 16,400,106	E581D	possibly damaging	Het
Uggt1	A	T	1: 36,161,771		probably null	Het
Wdr47	T	A	3: 108,633,156	Y622*	probably null	Het
Zfp644	A	T	5: 106,637,123	H519Q	probably damaging	Het
Zfp687	T	C	3: 95,011,217	M415V	possibly damaging	Het

Other mutations in Apob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Apob	APN	12	7993065	splice site	probably benign
IGL00421:Apob	APN	12	8010197	missense	probably damaging	0.99
IGL00658:Apob	APN	12	8009471	missense	probably benign	0.08
IGL00768:Apob	APN	12	8002107	missense	probably damaging	1.00
IGL00833:Apob	APN	12	8010101	missense	probably benign	0.14
IGL00926:Apob	APN	12	8015421	missense	probably benign	0.01
IGL01065:Apob	APN	12	8003299	missense	probably damaging	0.99
IGL01313:Apob	APN	12	8000898	missense	probably damaging	1.00
IGL01419:Apob	APN	12	8002251	missense	probably damaging	0.99
IGL01461:Apob	APN	12	8001884	missense	probably benign	0.13
IGL02002:Apob	APN	12	7994822	missense	probably benign	0.03
IGL02031:Apob	APN	12	8015222	missense	probably benign
IGL02102:Apob	APN	12	7989407	missense	possibly damaging	0.94
IGL02115:Apob	APN	12	7992923	missense	probably benign	0.06
IGL02513:Apob	APN	12	7992979	missense	probably benign	0.01
IGL02967:Apob	APN	12	8015366	nonsense	probably null
IGL03005:Apob	APN	12	7993059	splice site	probably benign
IGL03011:Apob	APN	12	7997883	missense	probably damaging	1.00
IGL03116:Apob	APN	12	8016350	missense	probably damaging	0.98
IGL03215:Apob	APN	12	8013818	missense	possibly damaging	0.92
IGL03227:Apob	APN	12	8016089	missense	probably benign	0.04
Essence	UTSW	12	8007769	nonsense	probably null
Ethos	UTSW	12	7990394	missense	probably null	1.00
IGL02835:Apob	UTSW	12	8015097	missense	possibly damaging	0.86
IGL02837:Apob	UTSW	12	8005102	missense	probably damaging	1.00
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0116:Apob	UTSW	12	7989113	unclassified	probably benign
R0180:Apob	UTSW	12	8008285	nonsense	probably null
R0288:Apob	UTSW	12	7990779	nonsense	probably null
R0295:Apob	UTSW	12	8002181	nonsense	probably null
R0305:Apob	UTSW	12	8012210	missense	probably damaging	1.00
R0312:Apob	UTSW	12	8009034	missense	probably benign
R0324:Apob	UTSW	12	8010521	missense	probably benign	0.41
R0326:Apob	UTSW	12	7990307	missense	probably damaging	1.00
R0363:Apob	UTSW	12	8010136	missense	probably damaging	1.00
R0390:Apob	UTSW	12	7988678	missense	probably damaging	0.99
R0462:Apob	UTSW	12	8000896	missense	probably damaging	1.00
R0471:Apob	UTSW	12	7990406	missense	probably damaging	1.00
R0532:Apob	UTSW	12	8016188	missense	possibly damaging	0.48
R0548:Apob	UTSW	12	8006282	missense	probably damaging	1.00
R0560:Apob	UTSW	12	8005101	missense	probably damaging	1.00
R0595:Apob	UTSW	12	8008369	missense	probably benign	0.01
R0600:Apob	UTSW	12	8006440	missense	probably damaging	1.00
R0626:Apob	UTSW	12	8016193	missense	probably benign	0.45
R0685:Apob	UTSW	12	8010742	missense	probably benign
R0765:Apob	UTSW	12	8016518	missense	probably benign
R0790:Apob	UTSW	12	8010245	missense	probably damaging	1.00
R0918:Apob	UTSW	12	7983941	missense	probably benign	0.10
R0962:Apob	UTSW	12	7989191	missense	probably damaging	0.98
R1055:Apob	UTSW	12	7994963	missense	probably damaging	1.00
R1077:Apob	UTSW	12	8006017	missense	probably benign
R1143:Apob	UTSW	12	8012354	missense	probably benign	0.26
R1163:Apob	UTSW	12	8011654	missense	probably damaging	1.00
R1266:Apob	UTSW	12	8006093	missense	probably benign	0.37
R1434:Apob	UTSW	12	8009715	missense	probably damaging	1.00
R1442:Apob	UTSW	12	7986165	missense	probably benign	0.31
R1445:Apob	UTSW	12	8016084	missense	possibly damaging	0.48
R1459:Apob	UTSW	12	8006047	missense	probably benign
R1459:Apob	UTSW	12	8011937	missense	possibly damaging	0.92
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1508:Apob	UTSW	12	8011481	missense	possibly damaging	0.92
R1518:Apob	UTSW	12	7989207	missense	probably benign	0.01
R1531:Apob	UTSW	12	7997880	missense	possibly damaging	0.65
R1547:Apob	UTSW	12	8003368	missense	probably benign	0.08
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1682:Apob	UTSW	12	8012365	missense	probably benign	0.00
R1709:Apob	UTSW	12	8009306	missense	probably damaging	0.98
R1718:Apob	UTSW	12	8016087	missense	probably benign	0.02
R1752:Apob	UTSW	12	7988766	missense	probably benign	0.01
R1781:Apob	UTSW	12	8009603	missense	possibly damaging	0.96
R1818:Apob	UTSW	12	8006834	missense	probably damaging	0.98
R1818:Apob	UTSW	12	8013064	missense	possibly damaging	0.93
R1842:Apob	UTSW	12	8011559	missense	probably damaging	1.00
R1843:Apob	UTSW	12	8007602	missense	possibly damaging	0.65
R1853:Apob	UTSW	12	8010928	nonsense	probably null
R1990:Apob	UTSW	12	8001039	missense	probably damaging	1.00
R2016:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2017:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2023:Apob	UTSW	12	8011090	missense	probably benign	0.01
R2037:Apob	UTSW	12	8007488	missense	probably benign	0.37
R2054:Apob	UTSW	12	8013134	missense	probably damaging	1.00
R2057:Apob	UTSW	12	8002164	nonsense	probably null
R2085:Apob	UTSW	12	8012240	missense	probably damaging	1.00
R2159:Apob	UTSW	12	8010081	missense	probably benign	0.12
R2209:Apob	UTSW	12	8007752	missense	probably benign	0.28
R2249:Apob	UTSW	12	8007499	missense	probably damaging	1.00
R2254:Apob	UTSW	12	8011256	missense	possibly damaging	0.92
R2265:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2266:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2267:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2268:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2296:Apob	UTSW	12	7994879	missense	probably damaging	0.97
R2897:Apob	UTSW	12	8010356	missense	probably damaging	1.00
R3431:Apob	UTSW	12	8010778	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8006327	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8011763	missense	possibly damaging	0.46
R3899:Apob	UTSW	12	8015849	missense	possibly damaging	0.87
R4020:Apob	UTSW	12	7994914	nonsense	probably null
R4050:Apob	UTSW	12	8015390	missense	probably benign	0.02
R4351:Apob	UTSW	12	7993054	missense	probably benign	0.03
R4365:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4366:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4456:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4458:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4600:Apob	UTSW	12	8008568	missense	probably damaging	1.00
R4611:Apob	UTSW	12	8011331	missense	probably damaging	1.00
R4646:Apob	UTSW	12	8012759	missense	probably benign	0.21
R4678:Apob	UTSW	12	7995585	missense	probably damaging	1.00
R4685:Apob	UTSW	12	8006456	missense	probably benign	0.00
R4707:Apob	UTSW	12	8006205	missense	probably damaging	0.96
R4726:Apob	UTSW	12	7990267	missense	probably damaging	0.98
R4792:Apob	UTSW	12	8008051	missense	probably benign	0.26
R4822:Apob	UTSW	12	8015741	missense	probably benign	0.04
R4834:Apob	UTSW	12	8014101	missense	possibly damaging	0.49
R4835:Apob	UTSW	12	8015391	missense	possibly damaging	0.56
R4887:Apob	UTSW	12	8013099	missense	probably damaging	1.00
R4910:Apob	UTSW	12	8007848	missense	probably damaging	1.00
R5072:Apob	UTSW	12	8008714	missense	probably benign	0.00
R5073:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5074:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5101:Apob	UTSW	12	8011934	missense	probably benign	0.09
R5123:Apob	UTSW	12	8007630	unclassified	probably null
R5133:Apob	UTSW	12	8008898	missense	probably damaging	0.99
R5135:Apob	UTSW	12	8010086	missense	probably damaging	1.00
R5137:Apob	UTSW	12	8011384	missense	possibly damaging	0.63
R5160:Apob	UTSW	12	8012126	missense	possibly damaging	0.90
R5173:Apob	UTSW	12	8008238	missense	probably benign	0.00
R5202:Apob	UTSW	12	8013737	missense	probably damaging	0.98
R5229:Apob	UTSW	12	7977806	missense	probably benign
R5292:Apob	UTSW	12	8005912	missense	probably benign	0.01
R5378:Apob	UTSW	12	8011865	missense	probably damaging	0.99
R5494:Apob	UTSW	12	8011762	missense	probably damaging	0.99
R5517:Apob	UTSW	12	7990906	missense	probably damaging	1.00
R5576:Apob	UTSW	12	7998662	missense	probably damaging	1.00
R5582:Apob	UTSW	12	8010788	missense	probably damaging	1.00
R5629:Apob	UTSW	12	8007847	missense	probably damaging	1.00
R5678:Apob	UTSW	12	7991494	missense	possibly damaging	0.92
R5734:Apob	UTSW	12	7988781	missense	probably damaging	1.00
R5742:Apob	UTSW	12	8007191	missense	probably damaging	1.00
R5751:Apob	UTSW	12	8012619	nonsense	probably null
R5776:Apob	UTSW	12	8006149	missense	possibly damaging	0.57
R5778:Apob	UTSW	12	8015074	missense	probably benign	0.45
R5783:Apob	UTSW	12	8001022	missense	probably damaging	1.00
R5786:Apob	UTSW	12	8015304	missense	possibly damaging	0.48
R5837:Apob	UTSW	12	8003277	missense	probably benign	0.04
R5857:Apob	UTSW	12	8015397	missense	probably benign	0.00
R6029:Apob	UTSW	12	8016243	missense	probably damaging	0.99
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6086:Apob	UTSW	12	8015164	missense	probably benign
R6110:Apob	UTSW	12	8011883	missense	probably damaging	1.00
R6131:Apob	UTSW	12	8015874	missense	probably benign	0.17
R6157:Apob	UTSW	12	8006077	missense	probably benign
R6179:Apob	UTSW	12	8005060	nonsense	probably null
R6247:Apob	UTSW	12	8001801	missense	probably damaging	1.00
R6279:Apob	UTSW	12	8007769	nonsense	probably null
R6300:Apob	UTSW	12	8007769	nonsense	probably null
R6320:Apob	UTSW	12	7989194	missense	probably benign	0.27
R6339:Apob	UTSW	12	8016188	missense	probably damaging	0.99
R6353:Apob	UTSW	12	8009421	missense	probably damaging	1.00
R6395:Apob	UTSW	12	8008507	missense	probably benign	0.45
R6441:Apob	UTSW	12	7987796	missense	probably damaging	1.00
R6492:Apob	UTSW	12	8008261	missense	probably damaging	0.99
R6495:Apob	UTSW	12	7990394	missense	probably null	1.00
R6502:Apob	UTSW	12	8001814	missense	probably damaging	0.99
R6520:Apob	UTSW	12	7983124	missense	probably damaging	1.00
R6644:Apob	UTSW	12	8009077	missense	probably damaging	0.97
R6704:Apob	UTSW	12	8010379	missense	probably damaging	0.98
R6750:Apob	UTSW	12	7997853	missense	probably damaging	1.00
R6759:Apob	UTSW	12	8011049	missense	probably benign	0.06
R6812:Apob	UTSW	12	7983062	missense	probably damaging	0.98
R6865:Apob	UTSW	12	8008847	missense	probably benign	0.05
R6873:Apob	UTSW	12	8015995	missense	probably benign	0.00
R7013:Apob	UTSW	12	8010080	nonsense	probably null
R7067:Apob	UTSW	12	8009423	missense	probably damaging	1.00
R7084:Apob	UTSW	12	8009591	missense	probably benign
R7113:Apob	UTSW	12	7995539	missense	probably damaging	1.00
R7175:Apob	UTSW	12	8007034	missense	probably benign	0.33
R7196:Apob	UTSW	12	7983893	missense	possibly damaging	0.90
R7199:Apob	UTSW	12	8005072	missense	probably damaging	1.00
R7205:Apob	UTSW	12	8005087	missense	probably damaging	0.98
R7251:Apob	UTSW	12	8007037	missense	probably damaging	0.98
R7474:Apob	UTSW	12	8009185	missense	probably benign	0.29
R7484:Apob	UTSW	12	8006884	nonsense	probably null
R7538:Apob	UTSW	12	8002219	missense	probably damaging	0.98
R7636:Apob	UTSW	12	8009516	missense	possibly damaging	0.86
R7646:Apob	UTSW	12	8009189	missense	probably damaging	0.99
R7787:Apob	UTSW	12	7990780	missense	probably damaging	0.97
R7793:Apob	UTSW	12	8008124	missense	probably damaging	0.99
X0027:Apob	UTSW	12	8007975	missense	probably benign
Z1088:Apob	UTSW	12	8005074	missense	possibly damaging	0.91
Z1088:Apob	UTSW	12	8005945	nonsense	probably null
Z1088:Apob	UTSW	12	8012936	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACAAGTTGAGTGTTCCTAGGCTG -3'
(R):5'- GTTGGCATTGTGCTCACCAG -3'

Sequencing Primer
(F):5'- GGACTTCTCCAGTAAGGCTTC -3'
(R):5'- GCCTTTGCGTCCTTGAGCAG -3'

Posted On

2017-01-03