Incidental Mutation 'R5732:Cdadc1'
ID451509
Institutional Source Beutler Lab
Gene Symbol Cdadc1
Ensembl Gene ENSMUSG00000021982
Gene Namecytidine and dCMP deaminase domain containing 1
Synonyms2310010M10Rik, NYD-SP15
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59559388-59597959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59596911 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 44 (L44P)
Ref Sequence ENSEMBL: ENSMUSP00000128064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022555] [ENSMUST00000056997] [ENSMUST00000167100] [ENSMUST00000171683] [ENSMUST00000225839]
Predicted Effect probably damaging
Transcript: ENSMUST00000022555
AA Change: L44P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022555
Gene: ENSMUSG00000021982
AA Change: L44P

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.2e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056997
AA Change: L44P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052233
Gene: ENSMUSG00000021982
AA Change: L44P

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.8e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167100
AA Change: L44P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128022
Gene: ENSMUSG00000021982
AA Change: L44P

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 4.9e-9 PFAM
Pfam:dCMP_cyt_deam_1 317 446 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171683
AA Change: L44P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128064
Gene: ENSMUSG00000021982
AA Change: L44P

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 1.4e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225103
Predicted Effect probably damaging
Transcript: ENSMUST00000225839
AA Change: L44P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Cdadc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cdadc1 APN 14 59581369 missense probably damaging 1.00
IGL01897:Cdadc1 APN 14 59592537 critical splice acceptor site probably null
IGL02648:Cdadc1 APN 14 59586363 missense probably damaging 1.00
IGL02720:Cdadc1 APN 14 59586047 missense probably damaging 1.00
R0254:Cdadc1 UTSW 14 59575907 splice site probably benign
R0470:Cdadc1 UTSW 14 59573841 splice site probably benign
R0554:Cdadc1 UTSW 14 59586452 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586083 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586092 missense probably damaging 1.00
R1649:Cdadc1 UTSW 14 59573793 missense probably damaging 1.00
R1900:Cdadc1 UTSW 14 59586532 missense probably damaging 1.00
R1934:Cdadc1 UTSW 14 59589860 missense possibly damaging 0.91
R1976:Cdadc1 UTSW 14 59573768 missense probably damaging 1.00
R2061:Cdadc1 UTSW 14 59581334 missense probably damaging 1.00
R2136:Cdadc1 UTSW 14 59568044 splice site probably null
R2147:Cdadc1 UTSW 14 59597753 critical splice donor site probably null
R2929:Cdadc1 UTSW 14 59597835 start codon destroyed probably null 0.70
R2991:Cdadc1 UTSW 14 59586072 missense possibly damaging 0.68
R4179:Cdadc1 UTSW 14 59592486 missense probably benign 0.12
R4621:Cdadc1 UTSW 14 59586555 missense probably benign 0.00
R4814:Cdadc1 UTSW 14 59568991 frame shift probably null
R4816:Cdadc1 UTSW 14 59568991 frame shift probably null
R4817:Cdadc1 UTSW 14 59568991 frame shift probably null
R4872:Cdadc1 UTSW 14 59564524 missense probably benign 0.04
R5448:Cdadc1 UTSW 14 59573826 missense possibly damaging 0.94
R5642:Cdadc1 UTSW 14 59589923 missense possibly damaging 0.95
R6472:Cdadc1 UTSW 14 59586042 missense probably damaging 0.99
R6501:Cdadc1 UTSW 14 59586449 missense probably benign 0.00
R7332:Cdadc1 UTSW 14 59575764 missense possibly damaging 0.63
R7763:Cdadc1 UTSW 14 59573834 missense probably damaging 1.00
X0064:Cdadc1 UTSW 14 59575854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAATATGAGCTAGTTCGCTG -3'
(R):5'- GTTGTGGCCACTCTTGCTAAGG -3'

Sequencing Primer
(F):5'- TGTGGTTACAGGCACAGCATAC -3'
(R):5'- AAGGAAGCTTTTATTCTCCTGCCTG -3'
Posted On2017-01-03