Incidental Mutation 'R5732:Slc52a2'
ID451511
Institutional Source Beutler Lab
Gene Symbol Slc52a2
Ensembl Gene ENSMUSG00000022560
Gene Namesolute carrier protein 52, member 2
SynonymsGPCR42, Gpr172b, D15Ertd747e, 2010003P03Rik, PAR2
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5732 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location76538832-76544608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76541074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 434 (I434T)
Ref Sequence ENSEMBL: ENSMUSP00000023220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220]
Predicted Effect probably benign
Transcript: ENSMUST00000023219
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
AA Change: I434T

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560
AA Change: I434T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Slc52a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Slc52a2 APN 15 76540576 missense probably benign 0.09
R1118:Slc52a2 UTSW 15 76539608 unclassified probably benign
R1167:Slc52a2 UTSW 15 76539591 missense probably benign 0.05
R1358:Slc52a2 UTSW 15 76540069 missense probably benign 0.00
R4683:Slc52a2 UTSW 15 76540233 missense probably damaging 1.00
R5015:Slc52a2 UTSW 15 76540551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCATGCTCAGCCCGCTG -3'
(R):5'- CAAAGCCAGGTCTCTTGTGG -3'

Sequencing Primer
(F):5'- GCTGCTGCGAATCTCCC -3'
(R):5'- TCTCTTGTGGAGTGTGAAATATCC -3'
Posted On2017-01-03