Incidental Mutation 'R5732:Slc35a4'
ID451514
Institutional Source Beutler Lab
Gene Symbol Slc35a4
Ensembl Gene ENSMUSG00000033272
Gene Namesolute carrier family 35, member A4
Synonyms
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36679215-36683861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36682341 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 75 (T75S)
Ref Sequence ENSEMBL: ENSMUSP00000140615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000115682] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036158
AA Change: T75S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272
AA Change: T75S

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
AA Change: T75S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272
AA Change: T75S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115682
SMART Domains Protein: ENSMUSP00000111346
Gene: ENSMUSG00000044719

DomainStartEndE-ValueType
Blast:KISc 1 105 2e-10 BLAST
SCOP:d1bg2__ 1 105 3e-9 SMART
low complexity region 120 130 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
coiled coil region 354 385 N/A INTRINSIC
coiled coil region 433 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
AA Change: T75S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272
AA Change: T75S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Slc35a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Slc35a4 APN 18 36682447 missense probably damaging 0.99
R0980:Slc35a4 UTSW 18 36682781 missense probably damaging 1.00
R1586:Slc35a4 UTSW 18 36683005 missense probably benign
R1723:Slc35a4 UTSW 18 36682735 missense possibly damaging 0.61
R3827:Slc35a4 UTSW 18 36682988 missense probably damaging 0.99
R5180:Slc35a4 UTSW 18 36682635 missense probably benign
R7101:Slc35a4 UTSW 18 36681538 missense probably damaging 0.99
R7257:Slc35a4 UTSW 18 36679616 missense unknown
R7402:Slc35a4 UTSW 18 36680517 missense unknown
R7606:Slc35a4 UTSW 18 36682585 missense probably benign 0.01
R8299:Slc35a4 UTSW 18 36682927 missense possibly damaging 0.89
Z1088:Slc35a4 UTSW 18 36683093 makesense probably null
Z1176:Slc35a4 UTSW 18 36682763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAAATGTGTCCCAGCCC -3'
(R):5'- CAGTACAATAGAGCTGTGCTTCC -3'

Sequencing Primer
(F):5'- TTGCTAGCTACCCAGGCCAC -3'
(R):5'- CAATAGAGCTGTGCTTCCAATCTTG -3'
Posted On2017-01-03