Incidental Mutation 'R5732:Nr3c1'
ID451515
Institutional Source Beutler Lab
Gene Symbol Nr3c1
Ensembl Gene ENSMUSG00000024431
Gene Namenuclear receptor subfamily 3, group C, member 1
SynonymsGrl-1, GR, Grl1, glucocorticoid receptor
MMRRC Submission 043347-MU
Accession Numbers

Genbank: NM_008173

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location39410545-39491301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39415699 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 741 (H741Q)
Ref Sequence ENSEMBL: ENSMUSP00000111233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025300] [ENSMUST00000097592] [ENSMUST00000115567] [ENSMUST00000115571]
Predicted Effect probably damaging
Transcript: ENSMUST00000025300
AA Change: H741Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025300
Gene: ENSMUSG00000024431
AA Change: H741Q

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097592
AA Change: H742Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095199
Gene: ENSMUSG00000024431
AA Change: H742Q

DomainStartEndE-ValueType
Pfam:GCR 27 86 9.2e-16 PFAM
Pfam:GCR 75 418 1.4e-161 PFAM
ZnF_C4 434 506 8.6e-35 SMART
HOLI 581 745 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115567
AA Change: H741Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111229
Gene: ENSMUSG00000024431
AA Change: H741Q

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115571
AA Change: H741Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111233
Gene: ENSMUSG00000024431
AA Change: H741Q

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die at birth of respiratory failure with underdeveloped lungs, enlarged adrenals, elevated serum corticosterone and ACTH, and failed adrenaline synthesis. Mice with a point mutation have impaired gluconeogenesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(3) Targeted, other(8) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Nr3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nr3c1 APN 18 39428608 splice site probably null
IGL00798:Nr3c1 APN 18 39486871 missense probably damaging 1.00
IGL01527:Nr3c1 APN 18 39486637 missense probably benign 0.00
IGL02088:Nr3c1 APN 18 39424391 missense probably damaging 1.00
IGL02244:Nr3c1 APN 18 39421557 unclassified probably benign
IGL03145:Nr3c1 APN 18 39486260 missense probably damaging 1.00
IGL03236:Nr3c1 APN 18 39486391 missense probably benign 0.00
3-1:Nr3c1 UTSW 18 39486039 missense probably benign
R1296:Nr3c1 UTSW 18 39486998 nonsense probably null
R2251:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2253:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2922:Nr3c1 UTSW 18 39487103 missense possibly damaging 0.93
R4667:Nr3c1 UTSW 18 39428727 missense probably benign 0.22
R4971:Nr3c1 UTSW 18 39486877 missense probably damaging 1.00
R5106:Nr3c1 UTSW 18 39486601 missense possibly damaging 0.80
R5939:Nr3c1 UTSW 18 39420653 missense probably benign 0.26
R5976:Nr3c1 UTSW 18 39421549 missense probably damaging 1.00
R6091:Nr3c1 UTSW 18 39486958 small deletion probably benign
R6666:Nr3c1 UTSW 18 39487147 missense probably damaging 1.00
R7073:Nr3c1 UTSW 18 39486396 missense probably benign 0.00
R7286:Nr3c1 UTSW 18 39486460 small insertion probably benign
R7289:Nr3c1 UTSW 18 39414601 missense probably benign 0.37
R7289:Nr3c1 UTSW 18 39422733 missense probably benign 0.03
R7334:Nr3c1 UTSW 18 39487037 missense probably benign 0.00
X0019:Nr3c1 UTSW 18 39487142 missense probably damaging 0.96
X0062:Nr3c1 UTSW 18 39428792 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTTTACGCAAATGACCAGACTAG -3'
(R):5'- ACGCATGAAATGTGCTACTTAG -3'

Sequencing Primer
(F):5'- AACCTAGGACCTACAATGTTCTTCTG -3'
(R):5'- CTAAGGAAGGTCTGAAGAGC -3'
Posted On2017-01-03