Incidental Mutation 'R5732:Rpgr'
ID451517
Institutional Source Beutler Lab
Gene Symbol Rpgr
Ensembl Gene ENSMUSG00000031174
Gene Nameretinitis pigmentosa GTPase regulator
SynonymsRp3h
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location10073621-10216920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10166272 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 857 (P857L)
Ref Sequence ENSEMBL: ENSMUSP00000111194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044598] [ENSMUST00000072393] [ENSMUST00000073392] [ENSMUST00000115532] [ENSMUST00000115533] [ENSMUST00000115534]
Predicted Effect probably benign
Transcript: ENSMUST00000044598
AA Change: P857L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037358
Gene: ENSMUSG00000031174
AA Change: P857L

DomainStartEndE-ValueType
Pfam:RCC1 91 140 2.4e-12 PFAM
Pfam:RCC1 143 193 2.1e-7 PFAM
Pfam:RCC1_2 180 209 4.5e-11 PFAM
Pfam:RCC1 196 243 2.2e-12 PFAM
Pfam:RCC1 246 296 6.3e-13 PFAM
Pfam:RCC1 300 348 9.9e-13 PFAM
Pfam:RCC1 352 402 2.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072393
AA Change: P564L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072229
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3e-8 PFAM
Pfam:RCC1 91 140 3.1e-13 PFAM
Pfam:RCC1 143 193 7.5e-9 PFAM
Pfam:RCC1_2 180 209 1.5e-11 PFAM
Pfam:RCC1 196 243 2.6e-13 PFAM
Pfam:RCC1 246 296 4.4e-13 PFAM
Pfam:RCC1 300 348 1.7e-12 PFAM
Pfam:RCC1 352 402 1.3e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073392
AA Change: P564L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073106
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3.3e-8 PFAM
Pfam:RCC1 91 140 3.5e-13 PFAM
Pfam:RCC1 143 193 8.4e-9 PFAM
Pfam:RCC1_2 180 209 1.7e-11 PFAM
Pfam:RCC1 196 243 3e-13 PFAM
Pfam:RCC1 246 296 4.9e-13 PFAM
Pfam:RCC1 300 348 1.9e-12 PFAM
Pfam:RCC1 352 402 1.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115532
AA Change: P857L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111194
Gene: ENSMUSG00000031174
AA Change: P857L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 1.1e-7 PFAM
Pfam:RCC1 91 140 1.3e-12 PFAM
Pfam:RCC1 143 193 3.1e-8 PFAM
Pfam:RCC1_2 180 209 5.5e-11 PFAM
Pfam:RCC1 196 243 1.1e-12 PFAM
Pfam:RCC1 246 296 1.8e-12 PFAM
Pfam:RCC1 300 348 6.8e-12 PFAM
Pfam:RCC1 352 402 5.4e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115533
AA Change: P564L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111195
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 7.1e-8 PFAM
Pfam:RCC1 91 140 8.4e-13 PFAM
Pfam:RCC1 143 193 2e-8 PFAM
Pfam:RCC1_2 180 209 3.7e-11 PFAM
Pfam:RCC1 196 243 7.1e-13 PFAM
Pfam:RCC1 246 296 1.2e-12 PFAM
Pfam:RCC1 300 348 4.4e-12 PFAM
Pfam:RCC1 352 402 3.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115534
AA Change: P469L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111196
Gene: ENSMUSG00000031174
AA Change: P469L

DomainStartEndE-ValueType
Pfam:RCC1 1 45 9.6e-11 PFAM
Pfam:RCC1 48 98 3.2e-8 PFAM
Pfam:RCC1_2 85 114 6.1e-11 PFAM
Pfam:RCC1 101 148 1.1e-12 PFAM
Pfam:RCC1 151 201 1.9e-12 PFAM
Pfam:RCC1 205 253 7.1e-12 PFAM
Pfam:RCC1 257 307 5.6e-9 PFAM
low complexity region 338 365 N/A INTRINSIC
low complexity region 491 509 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homo- and hemizygotes for an X-linked, targeted, null mutation exhibit ectopic placement of cone opsins, reduced levels of rhodopsin in rod cells, and partial degeneration of both cone and rod photoreceptors by 2-6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Rpgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rpgr APN X 10208709 missense possibly damaging 0.63
IGL02394:Rpgr APN X 10166217 missense probably benign 0.30
IGL02401:Rpgr APN X 10158717 missense possibly damaging 0.78
R3434:Rpgr UTSW X 10176602 missense probably benign 0.05
R4598:Rpgr UTSW X 10196016 missense probably benign 0.00
R5734:Rpgr UTSW X 10166272 missense probably benign 0.12
Z1177:Rpgr UTSW X 10158704 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAGGACATAACCTTGTCGCG -3'
(R):5'- CTGATGCAGTATCTTCATGTTCAG -3'

Sequencing Primer
(F):5'- GGACATAACCTTGTCGCGATACC -3'
(R):5'- GCAGTATCTTCATGTTCAGCATAGGC -3'
Posted On2017-01-03