Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Nrd1'

45152

Institutional Source

Beutler Lab

Gene Symbol

Nrd1

Ensembl Gene

ENSMUSG00000053510

Gene Name

nardilysin, N-arginine dibasic convertase, NRD convertase 1

Synonyms

NRD-C

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109000655-109061777 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 109047708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 712 (I712S)

Ref Sequence

ENSEMBL: ENSMUSP00000068328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]

AlphaFold

Q8BHG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000065977
AA Change: I712S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: I712S

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
low complexity region	172	209	N/A	INTRINSIC
Pfam:Peptidase_M16	210	348	1.1e-43	PFAM
Pfam:Peptidase_M16_C	373	559	2.3e-22	PFAM
Pfam:Peptidase_M16_C	849	1032	1.5e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102736
AA Change: I668S

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: I668S

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
low complexity region	172	209	N/A	INTRINSIC
Pfam:Peptidase_M16	210	348	1.4e-43	PFAM
Pfam:Peptidase_M16_C	400	515	1.1e-9	PFAM
Pfam:Peptidase_M16_C	805	988	2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106644
AA Change: I780S

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: I780S

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
coiled coil region	187	225	N/A	INTRINSIC
Pfam:Peptidase_M16	281	416	1e-41	PFAM
Pfam:Peptidase_M16_C	441	627	2.2e-23	PFAM
Pfam:Peptidase_M16_M	631	913	1e-91	PFAM
Pfam:Peptidase_M16_C	917	1100	6e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125645

SMART Domains

Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	1	100	6.4e-27	PFAM
Pfam:Peptidase_M16_C	125	311	1.9e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150177

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150784

Meta Mutation Damage Score

0.5767

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Nrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00577:Nrd1	APN	4	109046687	unclassified	probably benign
IGL00857:Nrd1	APN	4	109054002	missense	probably damaging	1.00
IGL01417:Nrd1	APN	4	109000830	utr 5 prime	probably benign
IGL01457:Nrd1	APN	4	109047660	missense	probably benign	0.03
IGL02112:Nrd1	APN	4	109027432	splice site	probably benign
IGL02279:Nrd1	APN	4	109024194	splice site	probably benign
IGL02332:Nrd1	APN	4	109000988	missense	probably damaging	0.99
IGL02890:Nrd1	APN	4	109053919	missense	possibly damaging	0.55
IGL03179:Nrd1	APN	4	109046691	unclassified	probably benign
PIT4354001:Nrd1	UTSW	4	109054025	critical splice donor site	probably null
R1468:Nrd1	UTSW	4	109016668	missense	probably benign	0.01
R1468:Nrd1	UTSW	4	109016668	missense	probably benign	0.01
R1990:Nrd1	UTSW	4	109039775	nonsense	probably null
R4391:Nrd1	UTSW	4	109046644	missense	probably damaging	1.00
R4994:Nrd1	UTSW	4	109046612	missense	probably benign
R5164:Nrd1	UTSW	4	109039717	missense	probably damaging	0.99
R5229:Nrd1	UTSW	4	109049108	missense	probably damaging	1.00
R5387:Nrd1	UTSW	4	109039762	missense	probably damaging	1.00
R5530:Nrd1	UTSW	4	109047609	missense	probably damaging	0.96
R5672:Nrd1	UTSW	4	109038045	nonsense	probably null
R5990:Nrd1	UTSW	4	109019071	missense	probably damaging	1.00
R6018:Nrd1	UTSW	4	109013747	missense	probably benign	0.01
R6106:Nrd1	UTSW	4	109044585	missense	probably damaging	0.99
R6114:Nrd1	UTSW	4	109044585	missense	probably damaging	0.99
R6140:Nrd1	UTSW	4	109049111	missense	probably damaging	0.97
R6285:Nrd1	UTSW	4	109038006	missense	probably damaging	0.99
R6824:Nrd1	UTSW	4	109043425	missense	probably damaging	1.00
R7019:Nrd1	UTSW	4	109028802	missense	probably benign	0.33
R7353:Nrd1	UTSW	4	109039749	missense	probably damaging	1.00
R7735:Nrd1	UTSW	4	109037985	missense	probably damaging	1.00
R8261:Nrd1	UTSW	4	109016679	missense	possibly damaging	0.67
R8340:Nrd1	UTSW	4	109001154	missense	probably damaging	1.00
R8352:Nrd1	UTSW	4	109019063	missense	probably damaging	0.98
R8368:Nrd1	UTSW	4	109013698	missense	probably benign	0.02
R8452:Nrd1	UTSW	4	109019063	missense	probably damaging	0.98
R9350:Nrd1	UTSW	4	109032461	missense	possibly damaging	0.93
R9428:Nrd1	UTSW	4	109000924	missense	probably damaging	0.99
R9516:Nrd1	UTSW	4	109044666	missense	probably benign
R9526:Nrd1	UTSW	4	109058636	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAATCTGCTGTTGGGAATGAGATAGCTT -3'
(R):5'- GTTTACCCCACAGGAGACACGC -3'

Sequencing Primer
(F):5'- GGAATGAGATAGCTTTAGTTTCCATC -3'
(R):5'- ccagggctacacagagaaac -3'

Posted On

2013-06-11