Incidental Mutation 'R5733:Anxa3'
ID451531
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Nameannexin A3
SynonymsAnx3
MMRRC Submission 043193-MU
Accession Numbers

Genbank: NM_013470; MGI: 1201378; Ensembl: ENSMUST00000112985

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location96793339-96845966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96820472 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 128 (I128N)
Ref Sequence ENSEMBL: ENSMUSP00000143491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631] [ENSMUST00000199330] [ENSMUST00000200379]
Predicted Effect probably damaging
Transcript: ENSMUST00000031447
AA Change: I128N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484
AA Change: I128N

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197339
Predicted Effect probably damaging
Transcript: ENSMUST00000198631
AA Change: I128N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484
AA Change: I128N

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199330
SMART Domains Protein: ENSMUSP00000143615
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 84 1.5e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199656
Predicted Effect possibly damaging
Transcript: ENSMUST00000200379
AA Change: I45N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142527
Gene: ENSMUSG00000029484
AA Change: I45N

DomainStartEndE-ValueType
ANX 24 76 7.2e-28 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96834771 splice site probably benign
IGL03243:Anxa3 APN 5 96828692 unclassified probably benign
F6893:Anxa3 UTSW 5 96824994 unclassified probably benign
R0026:Anxa3 UTSW 5 96838401 missense probably benign 0.01
R0468:Anxa3 UTSW 5 96811099 missense probably benign 0.00
R0562:Anxa3 UTSW 5 96812884 missense possibly damaging 0.90
R0724:Anxa3 UTSW 5 96828748 missense possibly damaging 0.70
R1442:Anxa3 UTSW 5 96828690 splice site probably null
R2276:Anxa3 UTSW 5 96830490 critical splice donor site probably null
R4922:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
R5108:Anxa3 UTSW 5 96830414 missense possibly damaging 0.83
R5230:Anxa3 UTSW 5 96838312 missense possibly damaging 0.47
R5529:Anxa3 UTSW 5 96828379 missense probably benign 0.00
R5857:Anxa3 UTSW 5 96828792 critical splice donor site probably null
R5902:Anxa3 UTSW 5 96812853 nonsense probably null
R6558:Anxa3 UTSW 5 96812939 splice site probably null
R6772:Anxa3 UTSW 5 96811113 missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96834821 missense probably benign 0.30
R7515:Anxa3 UTSW 5 96838320 missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96830404 missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTGTCGAGCAATATGAGGTC -3'
(R):5'- GCAGATCACATTCTAACTTGCCC -3'

Sequencing Primer
(F):5'- TCGAGCAATATGAGGTCCTACACTG -3'
(R):5'- CCCTGAACATGCACAGTTCATTGTAG -3'
Posted On2017-01-03