Incidental Mutation 'R5733:Garre1'
ID 451537
Institutional Source Beutler Lab
Gene Symbol Garre1
Ensembl Gene ENSMUSG00000066571
Gene Name granule associated Rac and RHOG effector 1
Synonyms 4931406P16Rik
MMRRC Submission 043193-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5733 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 33936132-34012976 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33944505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 76 (S76T)
Ref Sequence ENSEMBL: ENSMUSP00000145897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
AlphaFold Q8C5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000085592
AA Change: S792T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: S792T

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108074
AA Change: S792T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: S792T

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127010
Predicted Effect probably damaging
Transcript: ENSMUST00000205264
AA Change: S76T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect probably damaging
Transcript: ENSMUST00000206399
AA Change: S580T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T A 5: 35,762,543 (GRCm39) probably null Het
Ahnak2 A T 12: 112,742,100 (GRCm39) Y657* probably null Het
Anxa3 T A 5: 96,968,331 (GRCm39) I128N probably damaging Het
Bsnd T C 4: 106,345,198 (GRCm39) T83A probably benign Het
Capn10 A G 1: 92,871,635 (GRCm39) Y411C probably benign Het
Capn3 G A 2: 120,315,075 (GRCm39) W201* probably null Het
Crtap T C 9: 114,207,164 (GRCm39) T365A probably benign Het
Daam1 A G 12: 71,992,272 (GRCm39) D329G unknown Het
Dmxl2 A T 9: 54,283,550 (GRCm39) L2761Q possibly damaging Het
Fcho2 A C 13: 98,926,310 (GRCm39) V91G probably damaging Het
Fen1 A T 19: 10,178,022 (GRCm39) C141S possibly damaging Het
Fkbp15 G C 4: 62,225,166 (GRCm39) A831G probably benign Het
Frmd4a A T 2: 4,305,768 (GRCm39) R14S possibly damaging Het
Fzr1 A G 10: 81,206,160 (GRCm39) F176L possibly damaging Het
Garem2 A G 5: 30,321,336 (GRCm39) D565G probably damaging Het
Iqca1 G T 1: 89,998,257 (GRCm39) T549K probably damaging Het
Itgax T A 7: 127,739,647 (GRCm39) S686R probably damaging Het
Knop1 C A 7: 118,445,305 (GRCm39) G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 (GRCm39) C49S probably damaging Het
Mpzl1 A T 1: 165,433,180 (GRCm39) I157K probably benign Het
Mrgprb2 T C 7: 48,202,261 (GRCm39) I155V probably benign Het
Mucl3 T C 17: 35,949,102 (GRCm39) M166V probably benign Het
Mvb12b T C 2: 33,717,728 (GRCm39) T167A probably benign Het
Myh3 A G 11: 66,979,445 (GRCm39) N491S probably benign Het
Myo5b A G 18: 74,787,128 (GRCm39) D511G possibly damaging Het
Or10ak8 C T 4: 118,774,035 (GRCm39) V210I probably benign Het
Or11h4 T C 14: 50,974,509 (GRCm39) T37A probably benign Het
Or6b1 C T 6: 42,815,180 (GRCm39) R122C probably damaging Het
Or8k21 T G 2: 86,145,558 (GRCm39) Q24P probably damaging Het
Ptcd1 A G 5: 145,091,671 (GRCm39) M476T probably damaging Het
Pum3 A G 19: 27,398,695 (GRCm39) probably null Het
Ranbp2 G A 10: 58,321,658 (GRCm39) D2652N probably damaging Het
Rassf1 T C 9: 107,435,213 (GRCm39) V166A probably damaging Het
Rictor A G 15: 6,812,585 (GRCm39) H907R probably benign Het
Rorb T C 19: 18,965,471 (GRCm39) E6G probably damaging Het
Serpina3f A T 12: 104,183,182 (GRCm39) T15S possibly damaging Het
Sorbs2 T C 8: 46,212,226 (GRCm39) L100P probably damaging Het
Sprr2k T C 3: 92,340,655 (GRCm39) probably benign Het
Srrm2 T A 17: 24,040,360 (GRCm39) S2431T probably damaging Het
Stox2 T A 8: 47,866,172 (GRCm39) K57* probably null Het
Ttc21a G A 9: 119,770,327 (GRCm39) V133I probably benign Het
Vasn T C 16: 4,468,026 (GRCm39) Y658H possibly damaging Het
Zfp251 A G 15: 76,754,527 (GRCm39) Y35H probably damaging Het
Other mutations in Garre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Garre1 APN 7 33,945,412 (GRCm39) splice site probably benign
IGL00160:Garre1 APN 7 33,938,431 (GRCm39) missense possibly damaging 0.88
IGL00691:Garre1 APN 7 33,944,910 (GRCm39) missense probably damaging 1.00
IGL01312:Garre1 APN 7 33,955,933 (GRCm39) missense probably benign 0.19
IGL01954:Garre1 APN 7 33,944,460 (GRCm39) missense probably damaging 1.00
IGL02016:Garre1 APN 7 33,938,526 (GRCm39) missense possibly damaging 0.74
IGL02390:Garre1 APN 7 33,947,643 (GRCm39) missense probably damaging 1.00
IGL02407:Garre1 APN 7 33,955,909 (GRCm39) missense probably damaging 0.99
IGL02677:Garre1 APN 7 33,941,834 (GRCm39) splice site probably benign
IGL02929:Garre1 APN 7 33,944,507 (GRCm39) missense possibly damaging 0.46
IGL03285:Garre1 APN 7 33,984,416 (GRCm39) missense possibly damaging 0.81
I1329:Garre1 UTSW 7 33,944,619 (GRCm39) missense probably benign 0.00
R0004:Garre1 UTSW 7 33,955,853 (GRCm39) missense probably damaging 0.99
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0135:Garre1 UTSW 7 33,945,382 (GRCm39) missense probably damaging 1.00
R0137:Garre1 UTSW 7 33,938,644 (GRCm39) missense probably damaging 1.00
R0556:Garre1 UTSW 7 33,939,222 (GRCm39) missense probably damaging 0.99
R0687:Garre1 UTSW 7 33,944,843 (GRCm39) missense possibly damaging 0.95
R0928:Garre1 UTSW 7 33,947,671 (GRCm39) splice site probably null
R1719:Garre1 UTSW 7 33,947,631 (GRCm39) missense probably damaging 0.98
R1908:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1909:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1976:Garre1 UTSW 7 33,956,805 (GRCm39) missense probably damaging 0.99
R2496:Garre1 UTSW 7 33,955,916 (GRCm39) missense possibly damaging 0.93
R3005:Garre1 UTSW 7 33,984,209 (GRCm39) missense probably damaging 1.00
R4666:Garre1 UTSW 7 33,984,198 (GRCm39) missense probably damaging 0.98
R4832:Garre1 UTSW 7 33,938,333 (GRCm39) utr 3 prime probably benign
R4870:Garre1 UTSW 7 33,984,312 (GRCm39) missense possibly damaging 0.83
R4989:Garre1 UTSW 7 33,945,225 (GRCm39) missense probably damaging 1.00
R5033:Garre1 UTSW 7 33,945,237 (GRCm39) missense probably benign
R5308:Garre1 UTSW 7 33,945,180 (GRCm39) nonsense probably null
R5366:Garre1 UTSW 7 33,941,713 (GRCm39) missense possibly damaging 0.74
R5386:Garre1 UTSW 7 33,941,813 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,984,134 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,953,416 (GRCm39) missense possibly damaging 0.74
R5714:Garre1 UTSW 7 33,939,941 (GRCm39) nonsense probably null
R5772:Garre1 UTSW 7 33,953,413 (GRCm39) missense probably damaging 0.97
R6059:Garre1 UTSW 7 33,944,888 (GRCm39) missense possibly damaging 0.90
R6211:Garre1 UTSW 7 33,938,429 (GRCm39) missense possibly damaging 0.95
R6276:Garre1 UTSW 7 33,941,802 (GRCm39) nonsense probably null
R6477:Garre1 UTSW 7 33,957,055 (GRCm39) critical splice donor site probably null
R6757:Garre1 UTSW 7 33,938,502 (GRCm39) missense possibly damaging 0.89
R6912:Garre1 UTSW 7 33,945,093 (GRCm39) missense probably benign
R7156:Garre1 UTSW 7 33,945,133 (GRCm39) missense possibly damaging 0.80
R7317:Garre1 UTSW 7 33,963,072 (GRCm39) missense probably benign
R7431:Garre1 UTSW 7 33,984,219 (GRCm39) missense possibly damaging 0.73
R7452:Garre1 UTSW 7 33,945,096 (GRCm39) missense probably benign
R7996:Garre1 UTSW 7 33,963,024 (GRCm39) missense possibly damaging 0.77
R8348:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8448:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8989:Garre1 UTSW 7 33,956,869 (GRCm39) missense probably damaging 0.99
R9010:Garre1 UTSW 7 33,938,491 (GRCm39) missense probably benign 0.01
R9095:Garre1 UTSW 7 33,956,770 (GRCm39) critical splice donor site probably null
R9505:Garre1 UTSW 7 33,984,371 (GRCm39) missense probably damaging 1.00
R9530:Garre1 UTSW 7 33,963,069 (GRCm39) missense probably benign 0.01
R9612:Garre1 UTSW 7 33,947,656 (GRCm39) missense probably damaging 1.00
RF019:Garre1 UTSW 7 33,939,974 (GRCm39) missense probably damaging 0.98
X0021:Garre1 UTSW 7 33,944,788 (GRCm39) missense possibly damaging 0.94
Z1177:Garre1 UTSW 7 33,984,180 (GRCm39) missense probably damaging 0.96
Z1186:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1186:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1186:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1191:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCTCTAAGAATTCCTCAGTGAC -3'
(R):5'- AGTCCAGTACTACCAGCACCTG -3'

Sequencing Primer
(F):5'- TCCTCAGTGACTGTATTGAACG -3'
(R):5'- TGCTGCAACCCATTGGATCAC -3'
Posted On 2017-01-03