Incidental Mutation 'R5733:Knop1'
ID451539
Institutional Source Beutler Lab
Gene Symbol Knop1
Ensembl Gene ENSMUSG00000030980
Gene Namelysine rich nucleolar protein 1
SynonymsTsg118, 2310008H09Rik
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118842222-118856254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118846082 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 220 (G220C)
Ref Sequence ENSEMBL: ENSMUSP00000102159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033280] [ENSMUST00000059390] [ENSMUST00000063607] [ENSMUST00000106549] [ENSMUST00000106550] [ENSMUST00000106552] [ENSMUST00000106553] [ENSMUST00000116280] [ENSMUST00000126792]
Predicted Effect unknown
Transcript: ENSMUST00000033277
AA Change: G90C
SMART Domains Protein: ENSMUSP00000033277
Gene: ENSMUSG00000030980
AA Change: G90C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 435 509 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033280
Predicted Effect probably benign
Transcript: ENSMUST00000059390
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063607
AA Change: G272C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068142
Gene: ENSMUSG00000030980
AA Change: G272C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 239 251 6.9e-7 PROSPERO
internal_repeat_1 255 267 6.9e-7 PROSPERO
Pfam:SMAP 273 347 3.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106549
AA Change: G220C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102159
Gene: ENSMUSG00000030980
AA Change: G220C

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
internal_repeat_1 187 199 1.42e-6 PROSPERO
internal_repeat_1 203 215 1.42e-6 PROSPERO
Pfam:SMAP 221 295 3.3e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106550
AA Change: G434C
SMART Domains Protein: ENSMUSP00000102160
Gene: ENSMUSG00000030980
AA Change: G434C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 250 324 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106552
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106553
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000116280
AA Change: G434C
SMART Domains Protein: ENSMUSP00000111984
Gene: ENSMUSG00000030980
AA Change: G434C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 436 509 7e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126792
AA Change: G249C
SMART Domains Protein: ENSMUSP00000114727
Gene: ENSMUSG00000030980
AA Change: G249C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 251 324 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175952
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar protein that interacts with zinc finger 106 protein. The encoded protein has several of the same characteristics as nucleostemin and may be involved in testis development. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Knop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Knop1 APN 7 118852644 missense probably benign 0.09
IGL00840:Knop1 APN 7 118852798 missense probably damaging 0.96
IGL01484:Knop1 APN 7 118852809 missense probably damaging 0.99
IGL01608:Knop1 APN 7 118845796 missense probably benign 0.30
IGL03094:Knop1 APN 7 118853151 missense possibly damaging 0.92
R0147:Knop1 UTSW 7 118845838 missense probably benign 0.35
R0403:Knop1 UTSW 7 118853053 missense probably damaging 0.99
R0421:Knop1 UTSW 7 118855629 missense possibly damaging 0.53
R1483:Knop1 UTSW 7 118853050 missense probably damaging 0.96
R1513:Knop1 UTSW 7 118852449 unclassified probably benign
R1541:Knop1 UTSW 7 118855786 unclassified probably benign
R2366:Knop1 UTSW 7 118852528 missense possibly damaging 0.60
R2372:Knop1 UTSW 7 118853217 missense probably damaging 1.00
R2872:Knop1 UTSW 7 118855963 critical splice donor site probably null
R3001:Knop1 UTSW 7 118852449 unclassified probably benign
R3002:Knop1 UTSW 7 118852449 unclassified probably benign
R4723:Knop1 UTSW 7 118855864 unclassified probably benign
R4916:Knop1 UTSW 7 118846076 missense probably damaging 1.00
R5286:Knop1 UTSW 7 118855770 missense probably damaging 0.99
R5326:Knop1 UTSW 7 118853272 missense possibly damaging 0.91
R5950:Knop1 UTSW 7 118853334 missense probably damaging 1.00
R6741:Knop1 UTSW 7 118845838 missense possibly damaging 0.79
R7654:Knop1 UTSW 7 118845809 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATAGTCCTGCTGCAGACTC -3'
(R):5'- GTGCAGTGATATTTGTTAGAAGCC -3'

Sequencing Primer
(F):5'- ACGGGGACAGATGCTTAA -3'
(R):5'- CAATGATGGGCTCTCAGGCTG -3'
Posted On2017-01-03