Incidental Mutation 'R5733:Itgax'
ID451540
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128140475 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 686 (S686R)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: S686R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: S686R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAAGACCCAACTAGGTGAGTCTC -3'
(R):5'- CCAGATCTGGGGCTAAAGGTAG -3'

Sequencing Primer
(F):5'- CTTCCTTTTGATCTGACCTTGGGAAG -3'
(R):5'- GAAAGCTCAGAACATGCTGTG -3'
Posted On2017-01-03