Incidental Mutation 'R5733:Rassf1'
ID 451543
Institutional Source Beutler Lab
Gene Symbol Rassf1
Ensembl Gene ENSMUSG00000010067
Gene Name Ras association (RalGDS/AF-6) domain family member 1
Synonyms Rassf1A, RDA32, REH3P21, Rassf1C, Rassf1B, 123F protein, NORE2A
MMRRC Submission 043193-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R5733 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107428752-107439460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107435213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 166 (V166A)
Ref Sequence ENSEMBL: ENSMUSP00000010211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198]
AlphaFold Q99MK9
Predicted Effect probably damaging
Transcript: ENSMUST00000010211
AA Change: V166A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
RA 124 218 6.26e-24 SMART
PDB:4LGD|H 219 264 3e-13 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000093786
AA Change: V236A

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: V236A

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121635
SMART Domains Protein: ENSMUSP00000113037
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
RA 76 170 6.26e-24 SMART
PDB:4LGD|H 171 216 1e-13 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000122225
AA Change: V240A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: V240A

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191832
Predicted Effect probably benign
Transcript: ENSMUST00000156198
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T A 5: 35,762,543 (GRCm39) probably null Het
Ahnak2 A T 12: 112,742,100 (GRCm39) Y657* probably null Het
Anxa3 T A 5: 96,968,331 (GRCm39) I128N probably damaging Het
Bsnd T C 4: 106,345,198 (GRCm39) T83A probably benign Het
Capn10 A G 1: 92,871,635 (GRCm39) Y411C probably benign Het
Capn3 G A 2: 120,315,075 (GRCm39) W201* probably null Het
Crtap T C 9: 114,207,164 (GRCm39) T365A probably benign Het
Daam1 A G 12: 71,992,272 (GRCm39) D329G unknown Het
Dmxl2 A T 9: 54,283,550 (GRCm39) L2761Q possibly damaging Het
Fcho2 A C 13: 98,926,310 (GRCm39) V91G probably damaging Het
Fen1 A T 19: 10,178,022 (GRCm39) C141S possibly damaging Het
Fkbp15 G C 4: 62,225,166 (GRCm39) A831G probably benign Het
Frmd4a A T 2: 4,305,768 (GRCm39) R14S possibly damaging Het
Fzr1 A G 10: 81,206,160 (GRCm39) F176L possibly damaging Het
Garem2 A G 5: 30,321,336 (GRCm39) D565G probably damaging Het
Garre1 A T 7: 33,944,505 (GRCm39) S76T probably damaging Het
Iqca1 G T 1: 89,998,257 (GRCm39) T549K probably damaging Het
Itgax T A 7: 127,739,647 (GRCm39) S686R probably damaging Het
Knop1 C A 7: 118,445,305 (GRCm39) G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 (GRCm39) C49S probably damaging Het
Mpzl1 A T 1: 165,433,180 (GRCm39) I157K probably benign Het
Mrgprb2 T C 7: 48,202,261 (GRCm39) I155V probably benign Het
Mucl3 T C 17: 35,949,102 (GRCm39) M166V probably benign Het
Mvb12b T C 2: 33,717,728 (GRCm39) T167A probably benign Het
Myh3 A G 11: 66,979,445 (GRCm39) N491S probably benign Het
Myo5b A G 18: 74,787,128 (GRCm39) D511G possibly damaging Het
Or10ak8 C T 4: 118,774,035 (GRCm39) V210I probably benign Het
Or11h4 T C 14: 50,974,509 (GRCm39) T37A probably benign Het
Or6b1 C T 6: 42,815,180 (GRCm39) R122C probably damaging Het
Or8k21 T G 2: 86,145,558 (GRCm39) Q24P probably damaging Het
Ptcd1 A G 5: 145,091,671 (GRCm39) M476T probably damaging Het
Pum3 A G 19: 27,398,695 (GRCm39) probably null Het
Ranbp2 G A 10: 58,321,658 (GRCm39) D2652N probably damaging Het
Rictor A G 15: 6,812,585 (GRCm39) H907R probably benign Het
Rorb T C 19: 18,965,471 (GRCm39) E6G probably damaging Het
Serpina3f A T 12: 104,183,182 (GRCm39) T15S possibly damaging Het
Sorbs2 T C 8: 46,212,226 (GRCm39) L100P probably damaging Het
Sprr2k T C 3: 92,340,655 (GRCm39) probably benign Het
Srrm2 T A 17: 24,040,360 (GRCm39) S2431T probably damaging Het
Stox2 T A 8: 47,866,172 (GRCm39) K57* probably null Het
Ttc21a G A 9: 119,770,327 (GRCm39) V133I probably benign Het
Vasn T C 16: 4,468,026 (GRCm39) Y658H possibly damaging Het
Zfp251 A G 15: 76,754,527 (GRCm39) Y35H probably damaging Het
Other mutations in Rassf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rassf1 APN 9 107,435,510 (GRCm39) splice site probably benign
R0570:Rassf1 UTSW 9 107,435,165 (GRCm39) missense probably damaging 1.00
R1548:Rassf1 UTSW 9 107,429,045 (GRCm39) missense probably benign 0.00
R1826:Rassf1 UTSW 9 107,435,392 (GRCm39) missense probably damaging 0.99
R2312:Rassf1 UTSW 9 107,434,749 (GRCm39) missense probably damaging 1.00
R2899:Rassf1 UTSW 9 107,431,393 (GRCm39) missense probably null 0.00
R3902:Rassf1 UTSW 9 107,432,039 (GRCm39) missense probably damaging 1.00
R4705:Rassf1 UTSW 9 107,435,066 (GRCm39) missense probably benign 0.04
R5491:Rassf1 UTSW 9 107,438,614 (GRCm39) missense possibly damaging 0.95
R5863:Rassf1 UTSW 9 107,435,023 (GRCm39) missense probably damaging 1.00
R5986:Rassf1 UTSW 9 107,429,021 (GRCm39) missense possibly damaging 0.51
R7571:Rassf1 UTSW 9 107,428,982 (GRCm39) missense possibly damaging 0.70
R7841:Rassf1 UTSW 9 107,438,744 (GRCm39) makesense probably null
R8086:Rassf1 UTSW 9 107,435,173 (GRCm39) missense probably benign 0.38
R8784:Rassf1 UTSW 9 107,435,041 (GRCm39) missense probably benign
R8880:Rassf1 UTSW 9 107,434,740 (GRCm39) missense probably damaging 0.99
R8979:Rassf1 UTSW 9 107,429,004 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACTAGTGCGTCCTGTTTCAGTG -3'
(R):5'- TTCAAGGGCTGCTCGTCATC -3'

Sequencing Primer
(F):5'- TCAGTGCCTTCCAGCAAG -3'
(R):5'- TCATCCGACAGCTTCCGGAG -3'
Posted On 2017-01-03