Mutagenetix > Incidental Mutations

Incidental Mutation 'R5733:Ranbp2'

451546

Institutional Source

Beutler Lab

Gene Symbol

Ranbp2

Ensembl Gene

ENSMUSG00000003226

Gene Name

RAN binding protein 2

Synonyms

A430087B05Rik

MMRRC Submission

043193-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5733 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58446920-58494356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58485836 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 2652 (D2652N)

Ref Sequence

ENSEMBL: ENSMUSP00000003310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003310]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003310
AA Change: D2652N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: D2652N

Domain	Start	End	E-Value	Type
Pfam:TPR_1	60	93	1.8e-7	PFAM
Pfam:TPR_8	60	93	8.9e-6	PFAM
low complexity region	235	247	N/A	INTRINSIC
low complexity region	778	801	N/A	INTRINSIC
coiled coil region	808	832	N/A	INTRINSIC
RanBD	1166	1295	6.47e-64	SMART
ZnF_RBZ	1348	1372	5.49e-2	SMART
ZnF_RBZ	1412	1436	3.06e-6	SMART
ZnF_RBZ	1471	1495	4.16e-8	SMART
ZnF_RBZ	1500	1524	4.57e-5	SMART
ZnF_RBZ	1560	1584	3.52e-6	SMART
ZnF_RBZ	1619	1643	1.35e-7	SMART
RanBD	1850	1979	2.84e-60	SMART
low complexity region	2034	2048	N/A	INTRINSIC
low complexity region	2069	2090	N/A	INTRINSIC
low complexity region	2106	2121	N/A	INTRINSIC
RanBD	2147	2276	4.96e-83	SMART
low complexity region	2310	2317	N/A	INTRINSIC
low complexity region	2328	2342	N/A	INTRINSIC
Pfam:IR1-M	2468	2530	2.5e-27	PFAM
Pfam:IR1-M	2544	2604	7e-30	PFAM
low complexity region	2673	2684	N/A	INTRINSIC
low complexity region	2722	2732	N/A	INTRINSIC
RanBD	2741	2869	5e-79	SMART
Pfam:Pro_isomerase	2896	3052	4.5e-45	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,245,080	S76T	probably damaging	Het
Acox3	T	A	5: 35,605,199		probably null	Het
Ahnak2	A	T	12: 112,775,666	Y657*	probably null	Het
Anxa3	T	A	5: 96,820,472	I128N	probably damaging	Het
Bsnd	T	C	4: 106,488,001	T83A	probably benign	Het
Capn10	A	G	1: 92,943,913	Y411C	probably benign	Het
Capn3	G	A	2: 120,484,594	W201*	probably null	Het
Crtap	T	C	9: 114,378,096	T365A	probably benign	Het
Daam1	A	G	12: 71,945,498	D329G	unknown	Het
Dmxl2	A	T	9: 54,376,266	L2761Q	possibly damaging	Het
Dpcr1	T	C	17: 35,638,210	M166V	probably benign	Het
Fcho2	A	C	13: 98,789,802	V91G	probably damaging	Het
Fen1	A	T	19: 10,200,658	C141S	possibly damaging	Het
Fkbp15	G	C	4: 62,306,929	A831G	probably benign	Het
Frmd4a	A	T	2: 4,300,957	R14S	possibly damaging	Het
Fzr1	A	G	10: 81,370,326	F176L	possibly damaging	Het
Garem2	A	G	5: 30,116,338	D565G	probably damaging	Het
Iqca	G	T	1: 90,070,535	T549K	probably damaging	Het
Itgax	T	A	7: 128,140,475	S686R	probably damaging	Het
Knop1	C	A	7: 118,846,082	G220C	probably damaging	Het
Lyzl1	T	A	18: 4,169,142	C49S	probably damaging	Het
Mpzl1	A	T	1: 165,605,611	I157K	probably benign	Het
Mrgprb2	T	C	7: 48,552,513	I155V	probably benign	Het
Mvb12b	T	C	2: 33,827,716	T167A	probably benign	Het
Myh3	A	G	11: 67,088,619	N491S	probably benign	Het
Myo5b	A	G	18: 74,654,057	D511G	possibly damaging	Het
Olfr1053	T	G	2: 86,315,214	Q24P	probably damaging	Het
Olfr1329	C	T	4: 118,916,838	V210I	probably benign	Het
Olfr449	C	T	6: 42,838,246	R122C	probably damaging	Het
Olfr749	T	C	14: 50,737,052	T37A	probably benign	Het
Ptcd1	A	G	5: 145,154,861	M476T	probably damaging	Het
Pum3	A	G	19: 27,421,295		probably null	Het
Rassf1	T	C	9: 107,558,014	V166A	probably damaging	Het
Rictor	A	G	15: 6,783,104	H907R	probably benign	Het
Rorb	T	C	19: 18,988,107	E6G	probably damaging	Het
Serpina3f	A	T	12: 104,216,923	T15S	possibly damaging	Het
Sorbs2	T	C	8: 45,759,189	L100P	probably damaging	Het
Sprr2k	T	C	3: 92,433,348		probably benign	Het
Srrm2	T	A	17: 23,821,386	S2431T	probably damaging	Het
Stox2	T	A	8: 47,413,137	K57*	probably null	Het
Ttc21a	G	A	9: 119,941,261	V133I	probably benign	Het
Vasn	T	C	16: 4,650,162	Y658H	possibly damaging	Het
Zfp251	A	G	15: 76,870,327	Y35H	probably damaging	Het

Other mutations in Ranbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ranbp2	APN	10	58477256	missense	probably damaging	1.00
IGL00336:Ranbp2	APN	10	58451984	missense	probably damaging	1.00
IGL00486:Ranbp2	APN	10	58477612	missense	probably benign	0.06
IGL00800:Ranbp2	APN	10	58490704	missense	probably benign
IGL00834:Ranbp2	APN	10	58453323	missense	possibly damaging	0.94
IGL00852:Ranbp2	APN	10	58477901	missense	probably benign
IGL00984:Ranbp2	APN	10	58461964	nonsense	probably null
IGL01299:Ranbp2	APN	10	58492817	missense	probably damaging	1.00
IGL01325:Ranbp2	APN	10	58476298	missense	probably damaging	0.99
IGL01444:Ranbp2	APN	10	58475300	missense	possibly damaging	0.79
IGL01545:Ranbp2	APN	10	58478881	missense	possibly damaging	0.48
IGL01619:Ranbp2	APN	10	58464078	splice site	probably null
IGL01782:Ranbp2	APN	10	58478309	missense	probably damaging	0.97
IGL02020:Ranbp2	APN	10	58479947	missense	probably damaging	1.00
IGL02096:Ranbp2	APN	10	58461967	missense	probably damaging	1.00
IGL02182:Ranbp2	APN	10	58485760	nonsense	probably null
IGL02211:Ranbp2	APN	10	58478242	missense	probably benign
IGL02249:Ranbp2	APN	10	58480078	missense	possibly damaging	0.89
IGL02268:Ranbp2	APN	10	58493653	unclassified	probably benign
IGL02421:Ranbp2	APN	10	58480554	missense	probably damaging	1.00
IGL03080:Ranbp2	APN	10	58476791	missense	probably benign	0.01
IGL03119:Ranbp2	APN	10	58452003	missense	probably damaging	1.00
IGL03206:Ranbp2	APN	10	58465547	missense	probably damaging	1.00
IGL03237:Ranbp2	APN	10	58492961	missense	probably damaging	0.98
En_passant	UTSW	10	58452017	missense	probably damaging	1.00
red_river	UTSW	10	58465667	missense	probably damaging	1.00
IGL02799:Ranbp2	UTSW	10	58480264	missense	probably damaging	1.00
R0058:Ranbp2	UTSW	10	58480531	missense	probably damaging	0.98
R0058:Ranbp2	UTSW	10	58480531	missense	probably damaging	0.98
R0145:Ranbp2	UTSW	10	58480046	missense	probably damaging	1.00
R0309:Ranbp2	UTSW	10	58479868	missense	probably benign	0.04
R0375:Ranbp2	UTSW	10	58477283	missense	probably damaging	1.00
R0441:Ranbp2	UTSW	10	58485768	missense	probably benign	0.40
R0494:Ranbp2	UTSW	10	58467432	missense	possibly damaging	0.53
R0542:Ranbp2	UTSW	10	58478414	missense	probably benign	0.02
R0565:Ranbp2	UTSW	10	58476336	missense	probably benign	0.41
R0608:Ranbp2	UTSW	10	58493898	missense	probably damaging	1.00
R0661:Ranbp2	UTSW	10	58478733	missense	probably benign
R0670:Ranbp2	UTSW	10	58480698	missense	probably benign	0.01
R0760:Ranbp2	UTSW	10	58476791	missense	possibly damaging	0.70
R0811:Ranbp2	UTSW	10	58465529	missense	probably benign	0.01
R0812:Ranbp2	UTSW	10	58465529	missense	probably benign	0.01
R1180:Ranbp2	UTSW	10	58465463	missense	probably damaging	1.00
R1196:Ranbp2	UTSW	10	58477053	missense	probably damaging	1.00
R1216:Ranbp2	UTSW	10	58483212	splice site	probably benign
R1374:Ranbp2	UTSW	10	58485893	splice site	probably benign
R1541:Ranbp2	UTSW	10	58483094	missense	possibly damaging	0.90
R1589:Ranbp2	UTSW	10	58463986	missense	probably benign	0.01
R1711:Ranbp2	UTSW	10	58460519	missense	probably benign	0.11
R1761:Ranbp2	UTSW	10	58485741	missense	probably benign	0.02
R1831:Ranbp2	UTSW	10	58479222	nonsense	probably null
R1840:Ranbp2	UTSW	10	58478766	missense	probably benign	0.41
R1869:Ranbp2	UTSW	10	58492561	missense	probably damaging	1.00
R1871:Ranbp2	UTSW	10	58492561	missense	probably damaging	1.00
R1892:Ranbp2	UTSW	10	58464099	missense	probably benign	0.36
R2270:Ranbp2	UTSW	10	58455927	missense	probably benign	0.06
R2363:Ranbp2	UTSW	10	58478936	missense	possibly damaging	0.79
R3844:Ranbp2	UTSW	10	58477895	missense	possibly damaging	0.87
R3937:Ranbp2	UTSW	10	58476472	missense	probably benign	0.00
R3938:Ranbp2	UTSW	10	58476472	missense	probably benign	0.00
R4025:Ranbp2	UTSW	10	58480556	missense	probably benign	0.23
R4183:Ranbp2	UTSW	10	58465666	missense	possibly damaging	0.53
R4247:Ranbp2	UTSW	10	58478864	missense	possibly damaging	0.79
R4334:Ranbp2	UTSW	10	58463994	missense	probably damaging	1.00
R4656:Ranbp2	UTSW	10	58453422	missense	possibly damaging	0.82
R4746:Ranbp2	UTSW	10	58492670	missense	probably damaging	1.00
R4852:Ranbp2	UTSW	10	58477056	missense	possibly damaging	0.94
R4863:Ranbp2	UTSW	10	58492421	missense	probably damaging	0.99
R5011:Ranbp2	UTSW	10	58461895	missense	probably benign	0.36
R5014:Ranbp2	UTSW	10	58464120	missense	probably benign	0.40
R5145:Ranbp2	UTSW	10	58480038	missense	probably damaging	1.00
R5178:Ranbp2	UTSW	10	58476785	missense	probably benign	0.01
R5199:Ranbp2	UTSW	10	58464443	missense	probably benign
R5294:Ranbp2	UTSW	10	58478668	missense	probably benign	0.23
R5508:Ranbp2	UTSW	10	58480005	missense	probably damaging	0.97
R5511:Ranbp2	UTSW	10	58493739	missense	probably benign	0.29
R5575:Ranbp2	UTSW	10	58492583	missense	probably damaging	1.00
R5617:Ranbp2	UTSW	10	58465667	missense	probably damaging	1.00
R5630:Ranbp2	UTSW	10	58479076	missense	probably damaging	1.00
R5751:Ranbp2	UTSW	10	58464264	splice site	probably null
R5767:Ranbp2	UTSW	10	58476825	missense	probably benign	0.02
R6122:Ranbp2	UTSW	10	58465529	missense	probably benign	0.02
R6147:Ranbp2	UTSW	10	58479428	missense	probably damaging	1.00
R6286:Ranbp2	UTSW	10	58479572	missense	probably benign	0.02
R6344:Ranbp2	UTSW	10	58483886	splice site	probably null
R6452:Ranbp2	UTSW	10	58478157	missense	probably benign	0.00
R6487:Ranbp2	UTSW	10	58485741	missense	probably benign	0.02
R6620:Ranbp2	UTSW	10	58455807	critical splice acceptor site	probably null
R6759:Ranbp2	UTSW	10	58457737	nonsense	probably null
R7010:Ranbp2	UTSW	10	58454571	critical splice acceptor site	probably null
R7071:Ranbp2	UTSW	10	58492837	missense	probably damaging	1.00
R7083:Ranbp2	UTSW	10	58479230	missense	probably damaging	1.00
R7088:Ranbp2	UTSW	10	58463906	missense	probably damaging	1.00
R7102:Ranbp2	UTSW	10	58463950	missense	probably damaging	1.00
R7194:Ranbp2	UTSW	10	58476769	missense	probably benign	0.05
R7217:Ranbp2	UTSW	10	58452017	missense	probably damaging	1.00
R7318:Ranbp2	UTSW	10	58483087	nonsense	probably null
R7341:Ranbp2	UTSW	10	58485797	missense	possibly damaging	0.72
R7398:Ranbp2	UTSW	10	58467277	missense	probably damaging	1.00
R7424:Ranbp2	UTSW	10	58479194	missense	probably damaging	0.98
R7727:Ranbp2	UTSW	10	58455438	missense	probably benign	0.09
R7795:Ranbp2	UTSW	10	58483907	nonsense	probably null
R7812:Ranbp2	UTSW	10	58467402	missense	probably benign
R7845:Ranbp2	UTSW	10	58447022	missense	probably damaging	1.00
R7875:Ranbp2	UTSW	10	58478455	nonsense	probably null
R7934:Ranbp2	UTSW	10	58476475	missense	probably damaging	0.98
R8022:Ranbp2	UTSW	10	58485861	missense	possibly damaging	0.53
R8050:Ranbp2	UTSW	10	58479619	missense	probably damaging	0.99
R8100:Ranbp2	UTSW	10	58490648	missense	possibly damaging	0.58
R8194:Ranbp2	UTSW	10	58455925	missense	possibly damaging	0.84
R8258:Ranbp2	UTSW	10	58455933	missense	probably benign	0.04
R8259:Ranbp2	UTSW	10	58455933	missense	probably benign	0.04
R8461:Ranbp2	UTSW	10	58476394	missense	probably damaging	0.97
X0018:Ranbp2	UTSW	10	58478584	missense	probably benign	0.13
X0022:Ranbp2	UTSW	10	58465155	missense	probably benign	0.33
Z1088:Ranbp2	UTSW	10	58477972	frame shift	probably null
Z1088:Ranbp2	UTSW	10	58477983	frame shift	probably null
Z1088:Ranbp2	UTSW	10	58492893	missense	probably benign	0.35
Z1176:Ranbp2	UTSW	10	58461886	missense	probably damaging	1.00
Z1177:Ranbp2	UTSW	10	58493891	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AATCAGAGAGGTAGGTTGGTTC -3'
(R):5'- ACTGTGACAAATACATTATGCTCC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ACACATAGGCAGAACCTT -3'

Posted On

2017-01-03