Incidental Mutation 'R5733:Olfr749'
ID451553
Institutional Source Beutler Lab
Gene Symbol Olfr749
Ensembl Gene ENSMUSG00000059069
Gene Nameolfactory receptor 749
SynonymsGA_x6K02T2PMLR-6484046-6483105, MOR106-1
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5733 (G1)
Quality Score185
Status Not validated
Chromosome14
Chromosomal Location50736171-50745094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50737052 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000150627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074674] [ENSMUST00000214290]
Predicted Effect probably benign
Transcript: ENSMUST00000074674
AA Change: T37A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074242
Gene: ENSMUSG00000059069
AA Change: T37A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-53 PFAM
Pfam:7tm_1 40 289 7.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214290
AA Change: T37A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: A reporter allele shows expression of this olfactory receptor by embryonic day 15.5 and throughout olfactory development there is an increase in the numbers of expressing olfactory sensory neurons with expression localized to the dorsal main olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Olfr749
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03188:Olfr749 APN 14 50736858 nonsense probably null
R0141:Olfr749 UTSW 14 50736383 missense possibly damaging 0.94
R0462:Olfr749 UTSW 14 50737097 missense probably benign
R1424:Olfr749 UTSW 14 50737064 missense probably benign
R1791:Olfr749 UTSW 14 50736687 small insertion probably benign
R1912:Olfr749 UTSW 14 50736778 missense probably damaging 1.00
R2069:Olfr749 UTSW 14 50736576 missense possibly damaging 0.51
R2171:Olfr749 UTSW 14 50736419 missense probably benign 0.33
R2176:Olfr749 UTSW 14 50736224 missense probably benign
R2184:Olfr749 UTSW 14 50736602 missense probably damaging 0.98
R3158:Olfr749 UTSW 14 50736814 missense probably benign 0.01
R5068:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R5069:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R5070:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R6155:Olfr749 UTSW 14 50736619 missense probably benign 0.02
R6728:Olfr749 UTSW 14 50736839 missense possibly damaging 0.61
R7033:Olfr749 UTSW 14 50736707 missense possibly damaging 0.78
R7276:Olfr749 UTSW 14 50736730 missense possibly damaging 0.90
R7535:Olfr749 UTSW 14 50736665 missense probably benign 0.37
R8124:Olfr749 UTSW 14 50736286 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAAATGAGATGGCCTTGGTCTTAG -3'
(R):5'- GGTTTCAGAATACTCTTGTGTTTCC -3'

Sequencing Primer
(F):5'- AGATGGCCTTGGTCTTAGACAGAATG -3'
(R):5'- CCTTCAGACATATTGAAAGTAAGGG -3'
Posted On2017-01-03