Incidental Mutation 'R0551:Pcdh7'
ID 45156
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Name protocadherin 7
Synonyms BH-protocadherin
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 57875309-58290572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57879336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 964 (Y964H)
Ref Sequence ENSEMBL: ENSMUSP00000066306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
AlphaFold A0A0A6YY83
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: Y964H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: Y964H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000094783
AA Change: Y964H
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: Y964H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180708
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: Y964H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: Y964H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect unknown
Transcript: ENSMUST00000192287
AA Change: Y624H
Predicted Effect unknown
Transcript: ENSMUST00000195156
AA Change: Y278H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200266
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Meta Mutation Damage Score 0.1902 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57,878,806 (GRCm39) missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57,877,473 (GRCm39) missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57,877,806 (GRCm39) missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58,286,566 (GRCm39) missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57,877,546 (GRCm39) missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57,878,107 (GRCm39) missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57,877,764 (GRCm39) missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58,286,597 (GRCm39) missense probably benign
IGL02014:Pcdh7 APN 5 57,877,045 (GRCm39) missense probably benign 0.03
IGL02269:Pcdh7 APN 5 58,070,664 (GRCm39) missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58,286,415 (GRCm39) missense probably damaging 0.99
floated UTSW 5 57,878,704 (GRCm39) missense probably damaging 1.00
proposed UTSW 5 57,879,582 (GRCm39) missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 58,070,590 (GRCm39) missense probably benign 0.17
R0003:Pcdh7 UTSW 5 58,070,590 (GRCm39) missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57,877,402 (GRCm39) missense probably damaging 1.00
R0562:Pcdh7 UTSW 5 57,877,405 (GRCm39) missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57,878,657 (GRCm39) missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57,877,664 (GRCm39) missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57,876,768 (GRCm39) missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57,878,882 (GRCm39) nonsense probably null
R1591:Pcdh7 UTSW 5 57,877,764 (GRCm39) missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57,878,217 (GRCm39) missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57,876,971 (GRCm39) missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58,286,338 (GRCm39) missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58,286,458 (GRCm39) missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57,877,618 (GRCm39) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,879,236 (GRCm39) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,879,236 (GRCm39) missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58,286,374 (GRCm39) missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57,879,150 (GRCm39) missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57,876,631 (GRCm39) missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57,876,631 (GRCm39) missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57,879,361 (GRCm39) missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58,286,512 (GRCm39) missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57,877,827 (GRCm39) missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57,878,625 (GRCm39) missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58,286,511 (GRCm39) missense probably benign
R4837:Pcdh7 UTSW 5 57,877,753 (GRCm39) missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57,878,146 (GRCm39) missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57,879,258 (GRCm39) missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57,878,943 (GRCm39) missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57,879,508 (GRCm39) missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57,879,090 (GRCm39) missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57,885,463 (GRCm39) missense probably benign
R5248:Pcdh7 UTSW 5 58,286,515 (GRCm39) missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57,885,453 (GRCm39) splice site probably null
R5420:Pcdh7 UTSW 5 57,877,529 (GRCm39) missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57,876,856 (GRCm39) missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57,879,567 (GRCm39) missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57,878,970 (GRCm39) missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57,877,753 (GRCm39) missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57,879,097 (GRCm39) missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57,878,497 (GRCm39) missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57,877,666 (GRCm39) missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57,878,704 (GRCm39) missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 58,099,607 (GRCm39) splice site probably null
R6418:Pcdh7 UTSW 5 57,879,046 (GRCm39) missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57,876,471 (GRCm39) missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57,879,582 (GRCm39) missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57,877,126 (GRCm39) missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57,878,299 (GRCm39) missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57,878,340 (GRCm39) missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57,877,529 (GRCm39) missense probably damaging 1.00
R7588:Pcdh7 UTSW 5 57,877,246 (GRCm39) missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57,877,672 (GRCm39) missense probably damaging 0.99
R7734:Pcdh7 UTSW 5 57,876,976 (GRCm39) missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57,877,152 (GRCm39) missense probably benign
R8194:Pcdh7 UTSW 5 57,877,678 (GRCm39) missense probably damaging 1.00
R8480:Pcdh7 UTSW 5 58,286,407 (GRCm39) missense probably damaging 1.00
R8890:Pcdh7 UTSW 5 57,876,717 (GRCm39) missense probably damaging 1.00
R8906:Pcdh7 UTSW 5 57,879,154 (GRCm39) missense probably damaging 1.00
R8990:Pcdh7 UTSW 5 57,879,364 (GRCm39) missense probably benign 0.06
R9264:Pcdh7 UTSW 5 58,286,663 (GRCm39) missense probably benign 0.09
R9272:Pcdh7 UTSW 5 57,878,779 (GRCm39) missense possibly damaging 0.81
R9294:Pcdh7 UTSW 5 57,878,677 (GRCm39) missense probably benign 0.39
R9518:Pcdh7 UTSW 5 58,070,513 (GRCm39) missense possibly damaging 0.81
R9597:Pcdh7 UTSW 5 57,877,197 (GRCm39) missense possibly damaging 0.68
R9642:Pcdh7 UTSW 5 57,876,717 (GRCm39) missense probably damaging 1.00
R9745:Pcdh7 UTSW 5 57,879,622 (GRCm39) critical splice donor site probably null
X0021:Pcdh7 UTSW 5 57,878,826 (GRCm39) missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57,876,721 (GRCm39) missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57,877,006 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTCCGAAGTTTGCATACCCCAC -3'
(R):5'- TGCTCTGTCTCTGAGTGATCAGCC -3'

Sequencing Primer
(F):5'- TAGCTGGTGACCCAAGCTATG -3'
(R):5'- GCTCCCACAAATGTGTTGG -3'
Posted On 2013-06-11