Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Arap2'

45157

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 62641323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000076623

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200549

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62749094	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5426:Arap2	UTSW	5	62642816	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62676549	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62730705	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62730611	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62621981	splice site	probably null
R8277:Arap2	UTSW	5	62613992	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62604326	nonsense	probably null
R8398:Arap2	UTSW	5	62748909	missense	probably damaging	1.00
R8893:Arap2	UTSW	5	62730694	missense	probably damaging	1.00
R8973:Arap2	UTSW	5	62698325	nonsense	probably null
R9102:Arap2	UTSW	5	62748998	missense	probably benign	0.03
R9121:Arap2	UTSW	5	62748983	missense	possibly damaging	0.84
R9174:Arap2	UTSW	5	62698263	missense	probably damaging	1.00
R9222:Arap2	UTSW	5	62671078	missense	possibly damaging	0.96
R9281:Arap2	UTSW	5	62749505	missense	probably damaging	0.97
R9399:Arap2	UTSW	5	62606112	missense	possibly damaging	0.62
R9450:Arap2	UTSW	5	62698419	missense	probably benign	0.16
R9467:Arap2	UTSW	5	62730557	missense	probably benign	0.00
R9567:Arap2	UTSW	5	62604498	missense	probably benign	0.01
R9577:Arap2	UTSW	5	62611717	missense	probably damaging	1.00
R9626:Arap2	UTSW	5	62749535	missense	probably benign	0.00
R9688:Arap2	UTSW	5	62714766	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAAACCCACTGGCATAGCAAAGAG -3'
(R):5'- GGGCATCATCAAAGCACATTCCAAG -3'

Sequencing Primer
(F):5'- CTGGCATAGCAAAGAGTGTTTTGG -3'
(R):5'- GCTCCTGTGATCAAGATGATGC -3'

Posted On

2013-06-11