Incidental Mutation 'R0551:N4bp2'
ID 45158
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene Name NEDD4 binding protein 2
Synonyms LOC333789, B3bp, LOC386488
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 65920864-65987451 bp(+) (GRCm39)
Type of Mutation splice site (3057 bp from exon)
DNA Base Change (assembly) T to A at 65977684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
AlphaFold F8VQG7
Predicted Effect probably null
Transcript: ENSMUST00000087264
AA Change: Y1527*
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: Y1527*

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113738
AA Change: Y1527*
SMART Domains Protein: ENSMUSP00000109367
Gene: ENSMUSG00000037795
AA Change: Y1527*

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201044
Predicted Effect probably null
Transcript: ENSMUST00000201489
AA Change: Y1527*
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: Y1527*

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201615
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65,964,867 (GRCm39) missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65,960,890 (GRCm39) nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65,948,267 (GRCm39) missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65,955,477 (GRCm39) missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65,960,895 (GRCm39) missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65,965,020 (GRCm39) missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65,948,303 (GRCm39) missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65,960,916 (GRCm39) splice site probably benign
R0285:N4bp2 UTSW 5 65,963,902 (GRCm39) missense probably benign 0.00
R0366:N4bp2 UTSW 5 65,963,739 (GRCm39) missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65,965,496 (GRCm39) missense probably benign 0.39
R0671:N4bp2 UTSW 5 65,964,780 (GRCm39) missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65,965,815 (GRCm39) missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65,947,841 (GRCm39) missense probably benign 0.01
R1597:N4bp2 UTSW 5 65,964,483 (GRCm39) missense probably benign 0.45
R1628:N4bp2 UTSW 5 65,960,915 (GRCm39) splice site probably null
R1722:N4bp2 UTSW 5 65,964,225 (GRCm39) missense probably benign 0.08
R1735:N4bp2 UTSW 5 65,965,659 (GRCm39) missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65,948,165 (GRCm39) missense probably benign 0.12
R1759:N4bp2 UTSW 5 65,983,956 (GRCm39) missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65,964,168 (GRCm39) missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65,965,862 (GRCm39) missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65,951,861 (GRCm39) splice site probably benign
R2042:N4bp2 UTSW 5 65,983,964 (GRCm39) missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65,964,908 (GRCm39) missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65,948,224 (GRCm39) missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65,966,543 (GRCm39) missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65,964,071 (GRCm39) missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65,947,404 (GRCm39) missense probably benign 0.01
R2508:N4bp2 UTSW 5 65,947,404 (GRCm39) missense probably benign 0.01
R2919:N4bp2 UTSW 5 65,964,441 (GRCm39) missense probably benign 0.22
R3086:N4bp2 UTSW 5 65,948,396 (GRCm39) missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65,947,799 (GRCm39) missense probably benign 0.02
R4177:N4bp2 UTSW 5 65,955,513 (GRCm39) splice site probably null
R4718:N4bp2 UTSW 5 65,960,806 (GRCm39) missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65,982,641 (GRCm39) missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65,965,473 (GRCm39) missense probably benign 0.22
R4915:N4bp2 UTSW 5 65,960,847 (GRCm39) missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65,979,142 (GRCm39) splice site probably null
R4978:N4bp2 UTSW 5 65,947,583 (GRCm39) missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65,972,123 (GRCm39) missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65,969,320 (GRCm39) missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65,974,561 (GRCm39) missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65,965,805 (GRCm39) missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65,964,861 (GRCm39) missense probably benign
R5322:N4bp2 UTSW 5 65,947,800 (GRCm39) missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65,965,457 (GRCm39) missense probably benign 0.44
R5731:N4bp2 UTSW 5 65,966,500 (GRCm39) missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65,965,437 (GRCm39) missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65,948,344 (GRCm39) missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65,974,530 (GRCm39) missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65,964,189 (GRCm39) missense probably benign 0.01
R7112:N4bp2 UTSW 5 65,948,050 (GRCm39) missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65,965,365 (GRCm39) missense probably benign 0.00
R7177:N4bp2 UTSW 5 65,964,891 (GRCm39) missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65,951,888 (GRCm39) missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65,963,714 (GRCm39) missense probably benign 0.01
R7450:N4bp2 UTSW 5 65,982,643 (GRCm39) nonsense probably null
R7560:N4bp2 UTSW 5 65,948,458 (GRCm39) missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65,965,500 (GRCm39) missense probably benign 0.00
R7743:N4bp2 UTSW 5 65,965,802 (GRCm39) missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65,964,446 (GRCm39) missense probably benign 0.00
R7981:N4bp2 UTSW 5 65,969,485 (GRCm39) missense probably benign 0.41
R8065:N4bp2 UTSW 5 65,964,639 (GRCm39) missense probably damaging 0.99
R8067:N4bp2 UTSW 5 65,964,639 (GRCm39) missense probably damaging 0.99
R8164:N4bp2 UTSW 5 65,966,566 (GRCm39) missense probably damaging 1.00
R8166:N4bp2 UTSW 5 65,977,655 (GRCm39) missense probably benign 0.39
R8331:N4bp2 UTSW 5 65,964,943 (GRCm39) missense probably damaging 1.00
R8559:N4bp2 UTSW 5 65,982,628 (GRCm39) missense possibly damaging 0.62
R8806:N4bp2 UTSW 5 65,965,551 (GRCm39) missense possibly damaging 0.63
R9287:N4bp2 UTSW 5 65,960,855 (GRCm39) missense probably benign 0.38
R9369:N4bp2 UTSW 5 65,964,259 (GRCm39) missense probably damaging 0.97
R9460:N4bp2 UTSW 5 65,963,886 (GRCm39) missense probably benign 0.00
R9462:N4bp2 UTSW 5 65,947,898 (GRCm39) missense probably benign 0.02
R9605:N4bp2 UTSW 5 65,963,879 (GRCm39) missense probably benign 0.02
R9641:N4bp2 UTSW 5 65,948,035 (GRCm39) missense probably benign 0.15
Z1177:N4bp2 UTSW 5 65,964,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAACCCAGCTTCTGTGTAGCC -3'
(R):5'- AGCAGCTCAGTGGTAGAGCACTTG -3'

Sequencing Primer
(F):5'- accattctacactgaacacatcc -3'
(R):5'- GGCCTGAAGAACAACTGTATTC -3'
Posted On 2013-06-11