Incidental Mutation 'R0551:Albfm1'
ID 45160
Institutional Source Beutler Lab
Gene Symbol Albfm1
Ensembl Gene ENSMUSG00000070690
Gene Name albumin superfamily member 1
Synonyms 5830473C10Rik, Gm17754, ARG
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 90708966-90745730 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90720578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 250 (P250S)
Ref Sequence ENSEMBL: ENSMUSP00000144527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094615] [ENSMUST00000200765]
AlphaFold F8VQ07
Predicted Effect probably damaging
Transcript: ENSMUST00000094615
AA Change: P250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092198
Gene: ENSMUSG00000070690
AA Change: P250S

DomainStartEndE-ValueType
ALBUMIN 17 207 8.87e-26 SMART
ALBUMIN 214 399 1.45e-53 SMART
ALBUMIN 406 598 7.07e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200765
AA Change: P250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144527
Gene: ENSMUSG00000070690
AA Change: P250S

DomainStartEndE-ValueType
ALBUMIN 17 207 4.3e-28 SMART
ALBUMIN 214 355 3.3e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200893
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Albfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Albfm1 APN 5 90,727,438 (GRCm39) unclassified probably benign
IGL02343:Albfm1 APN 5 90,727,473 (GRCm39) missense probably damaging 0.99
IGL02749:Albfm1 APN 5 90,719,624 (GRCm39) missense possibly damaging 0.84
IGL02956:Albfm1 APN 5 90,727,497 (GRCm39) missense possibly damaging 0.46
R0097:Albfm1 UTSW 5 90,732,795 (GRCm39) missense probably benign 0.02
R0097:Albfm1 UTSW 5 90,732,795 (GRCm39) missense probably benign 0.02
R0513:Albfm1 UTSW 5 90,725,786 (GRCm39) missense probably benign 0.00
R1508:Albfm1 UTSW 5 90,729,780 (GRCm39) missense probably benign 0.00
R1797:Albfm1 UTSW 5 90,727,460 (GRCm39) missense probably damaging 0.99
R2205:Albfm1 UTSW 5 90,717,421 (GRCm39) missense possibly damaging 0.50
R2323:Albfm1 UTSW 5 90,732,711 (GRCm39) nonsense probably null
R2440:Albfm1 UTSW 5 90,720,548 (GRCm39) critical splice acceptor site probably null
R4074:Albfm1 UTSW 5 90,740,727 (GRCm39) splice site probably null
R4211:Albfm1 UTSW 5 90,712,096 (GRCm39) missense probably damaging 1.00
R4426:Albfm1 UTSW 5 90,720,642 (GRCm39) missense probably damaging 1.00
R4625:Albfm1 UTSW 5 90,719,611 (GRCm39) missense probably damaging 0.99
R4823:Albfm1 UTSW 5 90,714,362 (GRCm39) missense probably benign 0.01
R4922:Albfm1 UTSW 5 90,727,570 (GRCm39) missense possibly damaging 0.84
R4923:Albfm1 UTSW 5 90,709,158 (GRCm39) missense probably benign 0.07
R5218:Albfm1 UTSW 5 90,729,777 (GRCm39) missense probably benign 0.34
R5267:Albfm1 UTSW 5 90,732,716 (GRCm39) missense probably damaging 0.99
R5447:Albfm1 UTSW 5 90,732,169 (GRCm39) missense probably damaging 1.00
R5737:Albfm1 UTSW 5 90,720,642 (GRCm39) missense probably damaging 1.00
R5966:Albfm1 UTSW 5 90,719,546 (GRCm39) missense probably damaging 1.00
R6045:Albfm1 UTSW 5 90,732,848 (GRCm39) missense possibly damaging 0.86
R6290:Albfm1 UTSW 5 90,740,864 (GRCm39) critical splice donor site probably null
R6799:Albfm1 UTSW 5 90,727,474 (GRCm39) missense probably damaging 0.99
R6923:Albfm1 UTSW 5 90,725,652 (GRCm39) missense probably benign 0.32
R7088:Albfm1 UTSW 5 90,720,609 (GRCm39) nonsense probably null
R7238:Albfm1 UTSW 5 90,727,519 (GRCm39) missense probably damaging 1.00
R7319:Albfm1 UTSW 5 90,719,625 (GRCm39) critical splice donor site probably null
R7631:Albfm1 UTSW 5 90,727,531 (GRCm39) missense probably damaging 1.00
R7798:Albfm1 UTSW 5 90,745,370 (GRCm39) missense possibly damaging 0.72
R7821:Albfm1 UTSW 5 90,740,747 (GRCm39) missense possibly damaging 0.95
R8041:Albfm1 UTSW 5 90,740,864 (GRCm39) critical splice donor site probably null
R8353:Albfm1 UTSW 5 90,714,360 (GRCm39) missense possibly damaging 0.67
R8453:Albfm1 UTSW 5 90,714,360 (GRCm39) missense possibly damaging 0.67
R8762:Albfm1 UTSW 5 90,714,461 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GGGTCTGCACATCATCACCAAAGC -3'
(R):5'- AGACAATTCATGCCTGCTACAGCC -3'

Sequencing Primer
(F):5'- ACACTTCCTAATACTTGCTAATGC -3'
(R):5'- TGTCTATCTACTGACAGAAAGAAGC -3'
Posted On 2013-06-11