Incidental Mutation 'R0551:Auts2'
ID45162
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131440469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 446 (E446G)
Ref Sequence ENSEMBL: ENSMUSP00000124730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160071
SMART Domains Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 194 406 2.3e-108 PFAM
low complexity region 433 446 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 763 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161226
SMART Domains Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 11 45 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
low complexity region 330 355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161374
AA Change: E446G

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: E446G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161804
AA Change: E461G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: E461G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182974
Predicted Effect probably benign
Transcript: ENSMUST00000187544
AA Change: E670G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: E670G

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GGTGCATGTCCAAGTCACGGTAAG -3'
(R):5'- GGCTGGCAAGCCCATTTCATTTC -3'

Sequencing Primer
(F):5'- AGACTACCGATACTGTTCATGGC -3'
(R):5'- CTCTCACAGGGAAAGCGTTG -3'
Posted On2013-06-11