Incidental Mutation 'R5735:Scn3a'
ID451628
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5735 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65484459 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1086 (N1086I)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably benign
Transcript: ENSMUST00000066432
AA Change: N1086I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: N1086I

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100069
AA Change: N1086I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: N1086I

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGTCCAGACACAGGCTC -3'
(R):5'- ACTCCTGTCCTTCTGTCTAAAGAG -3'

Sequencing Primer
(F):5'- GACACAGGCTCGTCTGTAGTCTAATC -3'
(R):5'- AGAGTAGACCTTGCTCATGTTTC -3'
Posted On2017-01-03