Incidental Mutation 'R5735:Olfr1107'
ID 451631
Institutional Source Beutler Lab
Gene Symbol Olfr1107
Ensembl Gene ENSMUSG00000075163
Gene Name olfactory receptor 1107
Synonyms GA_x6K02T2Q125-48565383-48564445, MOR172-2
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5735 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87068671-87075817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87071412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000150135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099865] [ENSMUST00000214049]
AlphaFold A2AVB8
Predicted Effect probably damaging
Transcript: ENSMUST00000099865
AA Change: C241S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097450
Gene: ENSMUSG00000075163
AA Change: C241S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-53 PFAM
Pfam:7tm_1 41 290 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214049
AA Change: C241S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Olfr1107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Olfr1107 APN 2 87071219 missense probably benign 0.00
IGL01521:Olfr1107 APN 2 87071733 missense probably benign 0.11
IGL03350:Olfr1107 APN 2 87071560 missense probably damaging 1.00
PIT4791001:Olfr1107 UTSW 2 87071702 missense possibly damaging 0.94
R0801:Olfr1107 UTSW 2 87072063 nonsense probably null
R1383:Olfr1107 UTSW 2 87071792 missense probably damaging 1.00
R1577:Olfr1107 UTSW 2 87071397 missense probably benign 0.15
R1762:Olfr1107 UTSW 2 87071921 missense probably damaging 1.00
R2027:Olfr1107 UTSW 2 87071553 missense possibly damaging 0.85
R3850:Olfr1107 UTSW 2 87071966 missense possibly damaging 0.89
R5345:Olfr1107 UTSW 2 87071492 missense possibly damaging 0.61
R5409:Olfr1107 UTSW 2 87071870 missense possibly damaging 0.64
R5451:Olfr1107 UTSW 2 87071997 missense probably damaging 1.00
R6091:Olfr1107 UTSW 2 87071361 missense probably benign 0.03
R6869:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R7080:Olfr1107 UTSW 2 87071739 missense probably damaging 1.00
R8130:Olfr1107 UTSW 2 87071226 missense probably benign 0.09
R8147:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R9087:Olfr1107 UTSW 2 87071955 missense probably damaging 1.00
R9619:Olfr1107 UTSW 2 87071796 missense possibly damaging 0.94
Z1177:Olfr1107 UTSW 2 87071765 missense possibly damaging 0.72
Z1177:Olfr1107 UTSW 2 87072113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGAACTTCTTGGCTGC -3'
(R):5'- TGGTCCCAACATAGTGAATCAC -3'

Sequencing Primer
(F):5'- AATGAACTTCTTGGCTGCTTCTTTC -3'
(R):5'- AGTGAATCACTTCTTCTGTGACATC -3'
Posted On 2017-01-03