Incidental Mutation 'R5735:Kcna10'
ID451638
Institutional Source Beutler Lab
Gene Symbol Kcna10
Ensembl Gene ENSMUSG00000042861
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 10
SynonymsKcna8, Kv1.8
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5735 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107183056-107195721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107195078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 342 (I342V)
Ref Sequence ENSEMBL: ENSMUSP00000088118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055064]
Predicted Effect probably benign
Transcript: ENSMUST00000055064
AA Change: I342V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088118
Gene: ENSMUSG00000042861
AA Change: I342V

DomainStartEndE-ValueType
BTB 86 186 1.07e-6 SMART
Pfam:Ion_trans 215 468 3.4e-51 PFAM
Pfam:Ion_trans_2 376 461 6.2e-16 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significant vestibular and mild hearing dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Kcna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Kcna10 APN 3 107194728 missense probably damaging 1.00
IGL00481:Kcna10 APN 3 107195514 missense probably benign
IGL00645:Kcna10 APN 3 107195465 missense possibly damaging 0.95
IGL00974:Kcna10 APN 3 107195331 missense probably damaging 1.00
IGL03108:Kcna10 APN 3 107194943 missense probably benign 0.00
R0020:Kcna10 UTSW 3 107195420 missense probably damaging 1.00
R0421:Kcna10 UTSW 3 107194504 missense probably damaging 1.00
R0811:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R0812:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R2176:Kcna10 UTSW 3 107194716 missense probably damaging 1.00
R4405:Kcna10 UTSW 3 107195465 missense possibly damaging 0.95
R4668:Kcna10 UTSW 3 107194694 missense possibly damaging 0.83
R4703:Kcna10 UTSW 3 107194610 missense probably benign 0.22
R4719:Kcna10 UTSW 3 107194901 missense probably benign
R4736:Kcna10 UTSW 3 107195492 missense probably benign
R5227:Kcna10 UTSW 3 107194428 missense probably damaging 1.00
R5564:Kcna10 UTSW 3 107194229 missense probably benign
R7418:Kcna10 UTSW 3 107195046 missense probably benign 0.12
R7464:Kcna10 UTSW 3 107194079 missense probably damaging 0.99
R7699:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7700:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7978:Kcna10 UTSW 3 107194347 missense probably damaging 1.00
R8068:Kcna10 UTSW 3 107194410 missense possibly damaging 0.58
R8744:Kcna10 UTSW 3 107194386 missense probably damaging 1.00
X0026:Kcna10 UTSW 3 107195157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGTGGTTCACCTTTGAGC -3'
(R):5'- CCAGAAGCCATCAGGAATGC -3'

Sequencing Primer
(F):5'- GCTGGTGCTCCGGTTTG -3'
(R):5'- AAATGGGACTCTGGCTCATC -3'
Posted On2017-01-03