Incidental Mutation 'R5735:Ptpru'
ID451642
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5735 (G1)
Quality Score188
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131838090 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 23 (P23T)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]
Predicted Effect probably benign
Transcript: ENSMUST00000030741
AA Change: P23T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: P23T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105987
AA Change: P23T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: P23T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGGACAAACATGAGCCAG -3'
(R):5'- TTGAGAGTGCCGACCTGAAC -3'

Sequencing Primer
(F):5'- TCCACGCAGGCGACACTC -3'
(R):5'- GCCGATGGATCTTGTCGAC -3'
Posted On2017-01-03