Incidental Mutation 'R5735:9130019O22Rik'
ID 451652
Institutional Source Beutler Lab
Gene Symbol 9130019O22Rik
Ensembl Gene ENSMUSG00000030823
Gene Name RIKEN cDNA 9130019O22 gene
Synonyms
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5735 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127382260-127387166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 127385407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 174 (H174Q)
Ref Sequence ENSEMBL: ENSMUSP00000038195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345] [ENSMUST00000165495]
AlphaFold G3X941
Predicted Effect possibly damaging
Transcript: ENSMUST00000049052
AA Change: H174Q

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: H174Q

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in 9130019O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:9130019O22Rik APN 7 127386544 unclassified probably benign
IGL03102:9130019O22Rik APN 7 127384779 missense probably benign 0.01
IGL03264:9130019O22Rik APN 7 127385639 unclassified probably benign
R1653:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R1692:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R2042:9130019O22Rik UTSW 7 127385469 missense possibly damaging 0.93
R2132:9130019O22Rik UTSW 7 127386935 missense probably benign
R3768:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3769:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3770:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R4459:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4461:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4839:9130019O22Rik UTSW 7 127385007 missense probably benign 0.32
R4903:9130019O22Rik UTSW 7 127385406 missense probably benign 0.02
R5231:9130019O22Rik UTSW 7 127385414 missense probably damaging 0.98
R5324:9130019O22Rik UTSW 7 127384907 unclassified probably benign
R5808:9130019O22Rik UTSW 7 127384913 unclassified probably benign
R6429:9130019O22Rik UTSW 7 127385042 unclassified probably benign
R6571:9130019O22Rik UTSW 7 127385138 unclassified probably benign
R6655:9130019O22Rik UTSW 7 127384340 missense possibly damaging 0.96
R6806:9130019O22Rik UTSW 7 127386594 unclassified probably benign
R6962:9130019O22Rik UTSW 7 127384315 missense possibly damaging 0.70
R7091:9130019O22Rik UTSW 7 127384362 missense possibly damaging 0.70
R7204:9130019O22Rik UTSW 7 127384346 missense possibly damaging 0.92
R7218:9130019O22Rik UTSW 7 127384680 missense probably benign 0.32
R7570:9130019O22Rik UTSW 7 127385283 missense probably benign 0.00
R7604:9130019O22Rik UTSW 7 127386535 missense unknown
R7661:9130019O22Rik UTSW 7 127384963 nonsense probably null
R7893:9130019O22Rik UTSW 7 127386544 unclassified probably benign
R8323:9130019O22Rik UTSW 7 127384449 missense possibly damaging 0.71
R9172:9130019O22Rik UTSW 7 127385454 missense probably benign 0.38
R9204:9130019O22Rik UTSW 7 127385160 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTGTACATGTGTGCCACC -3'
(R):5'- CATGGTCTCCCAGCAGATTG -3'

Sequencing Primer
(F):5'- CATGTGTGCCACCAGTTTGGAC -3'
(R):5'- CTGAAGCAATGCAGAAGACATTTTC -3'
Posted On 2017-01-03