Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Nup210'

45166

Institutional Source

Beutler Lab

Gene Symbol

Nup210

Ensembl Gene

ENSMUSG00000030091

Gene Name

nucleoporin 210

Synonyms

gp190, Pom210, gp210

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91013068-91116829 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91021484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 774 (R774C)

Ref Sequence

ENSEMBL: ENSMUSP00000120098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]

AlphaFold

Q9QY81

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032179
AA Change: R1561C

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: R1561C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	3e-29	BLAST
low complexity region	850	862	N/A	INTRINSIC
Blast:S1	937	1022	6e-37	BLAST
BID_2	1077	1152	8.36e-6	SMART
low complexity region	1159	1168	N/A	INTRINSIC
Blast:BID_2	1468	1551	3e-35	BLAST
transmembrane domain	1809	1831	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113509
AA Change: R1517C

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: R1517C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	4e-29	BLAST
low complexity region	806	818	N/A	INTRINSIC
Blast:S1	893	978	4e-37	BLAST
BID_2	1033	1108	8.36e-6	SMART
low complexity region	1115	1124	N/A	INTRINSIC
Blast:BID_2	1424	1507	3e-35	BLAST
transmembrane domain	1765	1787	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141952

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142951
AA Change: R774C

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091
AA Change: R774C

Domain	Start	End	E-Value	Type
low complexity region	63	75	N/A	INTRINSIC
Blast:S1	150	235	3e-37	BLAST
BID_2	290	365	8.36e-6	SMART
low complexity region	372	381	N/A	INTRINSIC
Blast:BID_2	681	764	1e-35	BLAST
transmembrane domain	1022	1044	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148397

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Nup210

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Nup210	APN	6	91030097	missense	possibly damaging	0.92
IGL01532:Nup210	APN	6	91085999	splice site	probably benign
IGL01574:Nup210	APN	6	91040564	missense	probably benign	0.35
IGL01621:Nup210	APN	6	91030117	missense	probably damaging	1.00
IGL01976:Nup210	APN	6	91053614	missense	possibly damaging	0.89
IGL02089:Nup210	APN	6	91076698	missense	probably benign	0.04
IGL02291:Nup210	APN	6	91101268	missense	probably damaging	1.00
IGL03013:Nup210	APN	6	91053379	missense	probably benign	0.00
IGL03046:Nup210	APN	6	91018996	splice site	probably benign
IGL03136:Nup210	APN	6	91028861	missense	probably benign	0.32
IGL03139:Nup210	APN	6	91020239	missense	probably benign	0.08
IGL03195:Nup210	APN	6	91015850	missense	probably benign	0.32
IGL03344:Nup210	APN	6	91021429	missense	possibly damaging	0.53
brotherhood	UTSW	6	91036469	missense	possibly damaging	0.81
equality	UTSW	6	91021395	critical splice donor site	probably null
fraternity	UTSW	6	91042253	critical splice donor site	probably null
Liberty	UTSW	6	91020180	missense	probably benign	0.04
napoleonic	UTSW	6	91053452	missense	probably damaging	1.00
unity	UTSW	6	91031668	nonsense	probably null
IGL03134:Nup210	UTSW	6	91030190	missense	probably damaging	0.99
PIT4810001:Nup210	UTSW	6	91030124	missense	probably damaging	1.00
R0100:Nup210	UTSW	6	91069193	missense	probably benign	0.04
R0348:Nup210	UTSW	6	91074310	missense	probably benign	0.27
R0385:Nup210	UTSW	6	91028795	missense	possibly damaging	0.77
R0606:Nup210	UTSW	6	91026929	missense	possibly damaging	0.89
R1053:Nup210	UTSW	6	91028811	missense	probably benign	0.41
R1301:Nup210	UTSW	6	91042347	missense	possibly damaging	0.47
R1381:Nup210	UTSW	6	91075960	missense	probably damaging	0.99
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1487:Nup210	UTSW	6	91042576	missense	probably damaging	1.00
R1522:Nup210	UTSW	6	91069166	missense	possibly damaging	0.85
R1529:Nup210	UTSW	6	91036376	missense	probably damaging	1.00
R1531:Nup210	UTSW	6	91034841	missense	probably benign	0.05
R1668:Nup210	UTSW	6	91028805	missense	possibly damaging	0.89
R1694:Nup210	UTSW	6	91062803	missense	probably benign	0.09
R1803:Nup210	UTSW	6	91074282	missense	probably damaging	0.99
R1851:Nup210	UTSW	6	91016054	missense	probably damaging	1.00
R2145:Nup210	UTSW	6	91028876	missense	possibly damaging	0.81
R2196:Nup210	UTSW	6	91055244	missense	probably benign	0.02
R2308:Nup210	UTSW	6	91040868	missense	probably benign	0.19
R2419:Nup210	UTSW	6	91017556	splice site	probably benign
R2912:Nup210	UTSW	6	91026974	missense	probably damaging	1.00
R3413:Nup210	UTSW	6	91025242	missense	probably benign	0.00
R3718:Nup210	UTSW	6	91020180	missense	probably benign	0.04
R3753:Nup210	UTSW	6	91021395	critical splice donor site	probably null
R4058:Nup210	UTSW	6	91060620	missense	probably benign	0.02
R4840:Nup210	UTSW	6	91031668	nonsense	probably null
R4912:Nup210	UTSW	6	91017529	missense	probably benign	0.01
R4967:Nup210	UTSW	6	91036469	missense	possibly damaging	0.81
R4996:Nup210	UTSW	6	91053436	missense	probably benign	0.16
R5074:Nup210	UTSW	6	91055327	missense	probably benign	0.16
R5233:Nup210	UTSW	6	91026969	missense	probably damaging	1.00
R5352:Nup210	UTSW	6	91069316	missense	probably damaging	1.00
R5490:Nup210	UTSW	6	91085988	missense	probably damaging	0.98
R5511:Nup210	UTSW	6	91026963	missense	probably damaging	0.97
R5773:Nup210	UTSW	6	91085883	missense	probably damaging	0.96
R6064:Nup210	UTSW	6	91055291	missense	probably benign	0.01
R6209:Nup210	UTSW	6	91025355	missense	probably benign
R6299:Nup210	UTSW	6	91074288	missense	possibly damaging	0.68
R6705:Nup210	UTSW	6	91087960	missense	possibly damaging	0.50
R6855:Nup210	UTSW	6	91040853	missense	probably benign	0.13
R6856:Nup210	UTSW	6	91087913	nonsense	probably null
R6911:Nup210	UTSW	6	91030130	missense	probably damaging	0.98
R6955:Nup210	UTSW	6	91087927	missense	probably damaging	1.00
R7045:Nup210	UTSW	6	91054451	missense	probably damaging	1.00
R7081:Nup210	UTSW	6	91060665	missense	possibly damaging	0.50
R7163:Nup210	UTSW	6	91073331	missense	probably damaging	1.00
R7305:Nup210	UTSW	6	91087966	missense	probably damaging	1.00
R7387:Nup210	UTSW	6	91021396	critical splice donor site	probably null
R7404:Nup210	UTSW	6	91073245	missense	probably benign	0.01
R7469:Nup210	UTSW	6	91018892	missense	probably benign	0.08
R7603:Nup210	UTSW	6	91076697	missense	probably benign	0.00
R7731:Nup210	UTSW	6	91071888	missense	possibly damaging	0.50
R7822:Nup210	UTSW	6	91018777	missense	possibly damaging	0.71
R7944:Nup210	UTSW	6	91073197	missense	probably damaging	0.99
R8032:Nup210	UTSW	6	91074349	missense	probably benign	0.02
R8039:Nup210	UTSW	6	91070233	missense	probably benign	0.09
R8081:Nup210	UTSW	6	91076675	missense	probably benign	0.00
R8177:Nup210	UTSW	6	91014488	missense	probably benign
R8331:Nup210	UTSW	6	91053666	missense	possibly damaging	0.49
R8356:Nup210	UTSW	6	91074348	missense	probably benign	0.32
R8530:Nup210	UTSW	6	91076645	missense	possibly damaging	0.51
R8896:Nup210	UTSW	6	91042253	critical splice donor site	probably null
R8926:Nup210	UTSW	6	91053452	missense	probably damaging	1.00
R9093:Nup210	UTSW	6	91089890	missense	probably benign	0.16
R9130:Nup210	UTSW	6	91043817	missense	probably benign	0.08
R9136:Nup210	UTSW	6	91043848	missense	possibly damaging	0.53
R9260:Nup210	UTSW	6	91062803	missense	probably benign	0.09
R9292:Nup210	UTSW	6	91074253	missense	possibly damaging	0.81
R9444:Nup210	UTSW	6	91071903	missense	probably benign
R9482:Nup210	UTSW	6	91042626	missense	probably damaging	0.96
R9506:Nup210	UTSW	6	91071874	missense	possibly damaging	0.92
R9621:Nup210	UTSW	6	91017393	missense	probably benign	0.18
R9735:Nup210	UTSW	6	91053648	missense	probably benign	0.42
X0067:Nup210	UTSW	6	91074280	missense	probably damaging	1.00
Z1177:Nup210	UTSW	6	91020185	missense	probably benign
Z1177:Nup210	UTSW	6	91087907	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ACCTAAAGGGCACAGAGGCTACTC -3'
(R):5'- CCGACCAGGATTTAAGCTGTGAGC -3'

Sequencing Primer
(F):5'- ACAGAGGCTACTCCCCGC -3'
(R):5'- TCGTCGCTCAACACAACT -3'

Posted On

2013-06-11