Incidental Mutation 'R0551:Nup210'
ID 45166
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Name nucleoporin 210
Synonyms gp190, gp210, Pom210
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 90990050-91093811 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90998466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 774 (R774C)
Ref Sequence ENSEMBL: ENSMUSP00000120098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]
AlphaFold Q9QY81
Predicted Effect possibly damaging
Transcript: ENSMUST00000032179
AA Change: R1561C

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: R1561C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113509
AA Change: R1517C

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: R1517C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141952
Predicted Effect possibly damaging
Transcript: ENSMUST00000142951
AA Change: R774C

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091
AA Change: R774C

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
Blast:S1 150 235 3e-37 BLAST
BID_2 290 365 8.36e-6 SMART
low complexity region 372 381 N/A INTRINSIC
Blast:BID_2 681 764 1e-35 BLAST
transmembrane domain 1022 1044 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148397
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91,007,079 (GRCm39) missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91,062,981 (GRCm39) splice site probably benign
IGL01574:Nup210 APN 6 91,017,546 (GRCm39) missense probably benign 0.35
IGL01621:Nup210 APN 6 91,007,099 (GRCm39) missense probably damaging 1.00
IGL01976:Nup210 APN 6 91,030,596 (GRCm39) missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91,053,680 (GRCm39) missense probably benign 0.04
IGL02291:Nup210 APN 6 91,078,250 (GRCm39) missense probably damaging 1.00
IGL03013:Nup210 APN 6 91,030,361 (GRCm39) missense probably benign 0.00
IGL03046:Nup210 APN 6 90,995,978 (GRCm39) splice site probably benign
IGL03136:Nup210 APN 6 91,005,843 (GRCm39) missense probably benign 0.32
IGL03139:Nup210 APN 6 90,997,221 (GRCm39) missense probably benign 0.08
IGL03195:Nup210 APN 6 90,992,832 (GRCm39) missense probably benign 0.32
IGL03344:Nup210 APN 6 90,998,411 (GRCm39) missense possibly damaging 0.53
brotherhood UTSW 6 91,013,451 (GRCm39) missense possibly damaging 0.81
equality UTSW 6 90,998,377 (GRCm39) critical splice donor site probably null
fraternity UTSW 6 91,019,235 (GRCm39) critical splice donor site probably null
Liberty UTSW 6 90,997,162 (GRCm39) missense probably benign 0.04
napoleonic UTSW 6 91,030,434 (GRCm39) missense probably damaging 1.00
unity UTSW 6 91,008,650 (GRCm39) nonsense probably null
IGL03134:Nup210 UTSW 6 91,007,172 (GRCm39) missense probably damaging 0.99
PIT4810001:Nup210 UTSW 6 91,007,106 (GRCm39) missense probably damaging 1.00
R0100:Nup210 UTSW 6 91,046,175 (GRCm39) missense probably benign 0.04
R0348:Nup210 UTSW 6 91,051,292 (GRCm39) missense probably benign 0.27
R0385:Nup210 UTSW 6 91,005,777 (GRCm39) missense possibly damaging 0.77
R0606:Nup210 UTSW 6 91,003,911 (GRCm39) missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91,005,793 (GRCm39) missense probably benign 0.41
R1301:Nup210 UTSW 6 91,019,329 (GRCm39) missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91,052,942 (GRCm39) missense probably damaging 0.99
R1464:Nup210 UTSW 6 91,030,551 (GRCm39) missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91,030,551 (GRCm39) missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91,019,558 (GRCm39) missense probably damaging 1.00
R1522:Nup210 UTSW 6 91,046,148 (GRCm39) missense possibly damaging 0.85
R1529:Nup210 UTSW 6 91,013,358 (GRCm39) missense probably damaging 1.00
R1531:Nup210 UTSW 6 91,011,823 (GRCm39) missense probably benign 0.05
R1668:Nup210 UTSW 6 91,005,787 (GRCm39) missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91,039,785 (GRCm39) missense probably benign 0.09
R1803:Nup210 UTSW 6 91,051,264 (GRCm39) missense probably damaging 0.99
R1851:Nup210 UTSW 6 90,993,036 (GRCm39) missense probably damaging 1.00
R2145:Nup210 UTSW 6 91,005,858 (GRCm39) missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91,032,226 (GRCm39) missense probably benign 0.02
R2308:Nup210 UTSW 6 91,017,850 (GRCm39) missense probably benign 0.19
R2419:Nup210 UTSW 6 90,994,538 (GRCm39) splice site probably benign
R2912:Nup210 UTSW 6 91,003,956 (GRCm39) missense probably damaging 1.00
R3413:Nup210 UTSW 6 91,002,224 (GRCm39) missense probably benign 0.00
R3718:Nup210 UTSW 6 90,997,162 (GRCm39) missense probably benign 0.04
R3753:Nup210 UTSW 6 90,998,377 (GRCm39) critical splice donor site probably null
R4058:Nup210 UTSW 6 91,037,602 (GRCm39) missense probably benign 0.02
R4840:Nup210 UTSW 6 91,008,650 (GRCm39) nonsense probably null
R4912:Nup210 UTSW 6 90,994,511 (GRCm39) missense probably benign 0.01
R4967:Nup210 UTSW 6 91,013,451 (GRCm39) missense possibly damaging 0.81
R4996:Nup210 UTSW 6 91,030,418 (GRCm39) missense probably benign 0.16
R5074:Nup210 UTSW 6 91,032,309 (GRCm39) missense probably benign 0.16
R5233:Nup210 UTSW 6 91,003,951 (GRCm39) missense probably damaging 1.00
R5352:Nup210 UTSW 6 91,046,298 (GRCm39) missense probably damaging 1.00
R5490:Nup210 UTSW 6 91,062,970 (GRCm39) missense probably damaging 0.98
R5511:Nup210 UTSW 6 91,003,945 (GRCm39) missense probably damaging 0.97
R5773:Nup210 UTSW 6 91,062,865 (GRCm39) missense probably damaging 0.96
R6064:Nup210 UTSW 6 91,032,273 (GRCm39) missense probably benign 0.01
R6209:Nup210 UTSW 6 91,002,337 (GRCm39) missense probably benign
R6299:Nup210 UTSW 6 91,051,270 (GRCm39) missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91,064,942 (GRCm39) missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91,017,835 (GRCm39) missense probably benign 0.13
R6856:Nup210 UTSW 6 91,064,895 (GRCm39) nonsense probably null
R6911:Nup210 UTSW 6 91,007,112 (GRCm39) missense probably damaging 0.98
R6955:Nup210 UTSW 6 91,064,909 (GRCm39) missense probably damaging 1.00
R7045:Nup210 UTSW 6 91,031,433 (GRCm39) missense probably damaging 1.00
R7081:Nup210 UTSW 6 91,037,647 (GRCm39) missense possibly damaging 0.50
R7163:Nup210 UTSW 6 91,050,313 (GRCm39) missense probably damaging 1.00
R7305:Nup210 UTSW 6 91,064,948 (GRCm39) missense probably damaging 1.00
R7387:Nup210 UTSW 6 90,998,378 (GRCm39) critical splice donor site probably null
R7404:Nup210 UTSW 6 91,050,227 (GRCm39) missense probably benign 0.01
R7469:Nup210 UTSW 6 90,995,874 (GRCm39) missense probably benign 0.08
R7603:Nup210 UTSW 6 91,053,679 (GRCm39) missense probably benign 0.00
R7731:Nup210 UTSW 6 91,048,870 (GRCm39) missense possibly damaging 0.50
R7822:Nup210 UTSW 6 90,995,759 (GRCm39) missense possibly damaging 0.71
R7944:Nup210 UTSW 6 91,050,179 (GRCm39) missense probably damaging 0.99
R8032:Nup210 UTSW 6 91,051,331 (GRCm39) missense probably benign 0.02
R8039:Nup210 UTSW 6 91,047,215 (GRCm39) missense probably benign 0.09
R8081:Nup210 UTSW 6 91,053,657 (GRCm39) missense probably benign 0.00
R8177:Nup210 UTSW 6 90,991,470 (GRCm39) missense probably benign
R8331:Nup210 UTSW 6 91,030,648 (GRCm39) missense possibly damaging 0.49
R8356:Nup210 UTSW 6 91,051,330 (GRCm39) missense probably benign 0.32
R8530:Nup210 UTSW 6 91,053,627 (GRCm39) missense possibly damaging 0.51
R8896:Nup210 UTSW 6 91,019,235 (GRCm39) critical splice donor site probably null
R8926:Nup210 UTSW 6 91,030,434 (GRCm39) missense probably damaging 1.00
R9093:Nup210 UTSW 6 91,066,872 (GRCm39) missense probably benign 0.16
R9130:Nup210 UTSW 6 91,020,799 (GRCm39) missense probably benign 0.08
R9136:Nup210 UTSW 6 91,020,830 (GRCm39) missense possibly damaging 0.53
R9260:Nup210 UTSW 6 91,039,785 (GRCm39) missense probably benign 0.09
R9292:Nup210 UTSW 6 91,051,235 (GRCm39) missense possibly damaging 0.81
R9444:Nup210 UTSW 6 91,048,885 (GRCm39) missense probably benign
R9482:Nup210 UTSW 6 91,019,608 (GRCm39) missense probably damaging 0.96
R9506:Nup210 UTSW 6 91,048,856 (GRCm39) missense possibly damaging 0.92
R9621:Nup210 UTSW 6 90,994,375 (GRCm39) missense probably benign 0.18
R9735:Nup210 UTSW 6 91,030,630 (GRCm39) missense probably benign 0.42
X0067:Nup210 UTSW 6 91,051,262 (GRCm39) missense probably damaging 1.00
Z1177:Nup210 UTSW 6 91,064,889 (GRCm39) missense possibly damaging 0.91
Z1177:Nup210 UTSW 6 90,997,167 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTAAAGGGCACAGAGGCTACTC -3'
(R):5'- CCGACCAGGATTTAAGCTGTGAGC -3'

Sequencing Primer
(F):5'- ACAGAGGCTACTCCCCGC -3'
(R):5'- TCGTCGCTCAACACAACT -3'
Posted On 2013-06-11