Incidental Mutation 'R5735:Erlec1'
ID451664
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5735 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30950591 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 153 (N153K)
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000073192] [ENSMUST00000117883] [ENSMUST00000129593] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073192
AA Change: N153K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311
AA Change: N153K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117883
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155304
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGTGTTCACAAAATGGCTCTCTATG -3'
(R):5'- TGGGAAACATATTCGACAGTACC -3'

Sequencing Primer
(F):5'- CATATAGGCCTTGCTAGGTAAAGCC -3'
(R):5'- GAAACATATTCGACAGTACCATGAAG -3'
Posted On2017-01-03