Incidental Mutation 'R5735:Zfyve26'
ID 451668
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Name zinc finger, FYVE domain containing 26
Synonyms A630028O16Rik, 9330197E15Rik, LOC380767
MMRRC Submission 043349-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5735 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 79279120-79343078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79320147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1066 (D1066G)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]
AlphaFold Q5DU37
Predicted Effect probably damaging
Transcript: ENSMUST00000021547
AA Change: D1066G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: D1066G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Predicted Effect probably benign
Transcript: ENSMUST00000219912
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 C A 13: 70,984,337 (GRCm39) D109Y possibly damaging Het
Armc8 T A 9: 99,379,447 (GRCm39) probably null Het
Atg4b G T 1: 93,701,519 (GRCm39) G71V probably damaging Het
Atp10b A T 11: 43,042,601 (GRCm39) M54L probably benign Het
Baiap2l1 A G 5: 144,223,112 (GRCm39) L75P probably damaging Het
Bnc2 A C 4: 84,210,908 (GRCm39) L487R probably damaging Het
Cacng7 T C 7: 3,387,539 (GRCm39) S141P probably benign Het
Carmil2 G A 8: 106,424,663 (GRCm39) G1361D probably damaging Het
Cenpf T C 1: 189,386,560 (GRCm39) I1907V probably benign Het
Cep192 T C 18: 68,013,866 (GRCm39) V2422A probably benign Het
Cfap73 T A 5: 120,770,671 (GRCm39) Q33L probably benign Het
Cip2a T A 16: 48,837,856 (GRCm39) probably null Het
Cmtm2a A T 8: 105,019,418 (GRCm39) I57N probably damaging Het
Col6a2 T A 10: 76,435,727 (GRCm39) D836V probably benign Het
Dnah2 A G 11: 69,321,643 (GRCm39) V3839A possibly damaging Het
Enpp1 A T 10: 24,530,817 (GRCm39) F546L possibly damaging Het
Eps8l2 A G 7: 140,940,290 (GRCm39) T507A probably damaging Het
Erg28 C T 12: 85,862,926 (GRCm39) E129K probably benign Het
Erlec1 A T 11: 30,900,591 (GRCm39) N153K probably benign Het
Fam234a T C 17: 26,432,679 (GRCm39) E490G probably damaging Het
Fat4 C T 3: 39,003,725 (GRCm39) R1815C probably damaging Het
Galnt1 T G 18: 24,397,577 (GRCm39) I226S possibly damaging Het
Ifnl2 T A 7: 28,209,614 (GRCm39) I58F possibly damaging Het
Itih5 A G 2: 10,245,572 (GRCm39) N554D probably benign Het
Kcna10 A G 3: 107,102,394 (GRCm39) I342V probably benign Het
Kif6 G A 17: 50,139,210 (GRCm39) E561K probably damaging Het
Kl A G 5: 150,915,003 (GRCm39) N910S possibly damaging Het
Lpar2 G T 8: 70,276,385 (GRCm39) R58L probably damaging Het
Macrod2 A G 2: 140,260,809 (GRCm39) T27A possibly damaging Het
Mfsd2a A T 4: 122,843,120 (GRCm39) V387D probably damaging Het
Npas3 A T 12: 54,050,262 (GRCm39) T231S probably benign Het
Or4a70 A T 2: 89,323,812 (GRCm39) N281K probably damaging Het
Or52n5 A T 7: 104,587,966 (GRCm39) T78S probably benign Het
Or5aq1b A T 2: 86,901,756 (GRCm39) C241S probably damaging Het
Or8h10 A G 2: 86,809,044 (GRCm39) V32A probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pde10a A T 17: 9,160,024 (GRCm39) I432F probably damaging Het
Phka2 ACC AC X: 159,342,862 (GRCm39) probably null Het
Pomt1 G A 2: 32,133,517 (GRCm39) G218R probably damaging Het
Potefam1 A T 2: 111,055,837 (GRCm39) L183* probably null Het
Pramel22 A T 4: 143,381,205 (GRCm39) C273S probably damaging Het
Prdm5 C T 6: 65,904,974 (GRCm39) T157I possibly damaging Het
Psen2 T A 1: 180,068,491 (GRCm39) E54V probably benign Het
Ptpn13 C A 5: 103,702,686 (GRCm39) H1217Q probably benign Het
Ptprt A G 2: 161,376,484 (GRCm39) S1306P probably damaging Het
Ptpru G T 4: 131,565,401 (GRCm39) P23T probably benign Het
Rtn3 T C 19: 7,434,057 (GRCm39) E626G probably damaging Het
Scn3a A T 2: 65,312,622 (GRCm39) M1191K probably damaging Het
Scn3a T A 2: 65,314,803 (GRCm39) N1086I probably benign Het
Sgms2 A T 3: 131,129,866 (GRCm39) M174K probably damaging Het
Skor1 T A 9: 63,053,346 (GRCm39) I180F probably damaging Het
Slit2 T G 5: 48,416,958 (GRCm39) C1003W probably damaging Het
Tbc1d2b T A 9: 90,104,462 (GRCm39) Q560L possibly damaging Het
Themis A G 10: 28,598,530 (GRCm39) I51V probably benign Het
Tmem203 T C 2: 25,146,085 (GRCm39) V135A probably benign Het
Tns1 T C 1: 73,967,138 (GRCm39) T1212A probably benign Het
Trgv5 T G 13: 19,376,695 (GRCm39) H47Q probably benign Het
Trim2 G A 3: 84,075,029 (GRCm39) A697V probably damaging Het
Ubxn4 T C 1: 128,186,677 (GRCm39) S37P possibly damaging Het
Vmn2r17 A G 5: 109,600,716 (GRCm39) I671M possibly damaging Het
Vmn2r94 G T 17: 18,464,066 (GRCm39) S741R probably damaging Het
Vwce C A 19: 10,624,431 (GRCm39) D414E probably benign Het
Zfp397 T C 18: 24,093,249 (GRCm39) S245P possibly damaging Het
Zfp747l1 G T 7: 126,984,579 (GRCm39) H174Q possibly damaging Het
Zfp809 T A 9: 22,150,227 (GRCm39) Y241* probably null Het
Zfp995 C T 17: 22,101,010 (GRCm39) C29Y probably benign Het
Zfta A G 19: 7,400,161 (GRCm39) E209G probably benign Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79,296,234 (GRCm39) unclassified probably benign
IGL00940:Zfyve26 APN 12 79,327,674 (GRCm39) missense probably benign
IGL01148:Zfyve26 APN 12 79,307,644 (GRCm39) missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79,298,957 (GRCm39) splice site probably null
IGL01472:Zfyve26 APN 12 79,323,117 (GRCm39) missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79,291,147 (GRCm39) missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79,334,625 (GRCm39) missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79,308,348 (GRCm39) splice site probably null
IGL01689:Zfyve26 APN 12 79,330,827 (GRCm39) missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79,334,218 (GRCm39) missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79,291,174 (GRCm39) missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79,323,169 (GRCm39) missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79,315,621 (GRCm39) missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79,326,854 (GRCm39) missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79,285,794 (GRCm39) missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79,310,644 (GRCm39) missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79,308,565 (GRCm39) missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79,342,338 (GRCm39) missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79,330,846 (GRCm39) nonsense probably null
challenge UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
fourteener UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
IGL02799:Zfyve26 UTSW 12 79,320,084 (GRCm39) missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79,323,055 (GRCm39) missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79,291,258 (GRCm39) missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79,292,996 (GRCm39) missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79,315,502 (GRCm39) missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79,312,576 (GRCm39) splice site probably benign
R0738:Zfyve26 UTSW 12 79,342,308 (GRCm39) missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79,320,372 (GRCm39) missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79,318,901 (GRCm39) missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79,310,723 (GRCm39) missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79,321,694 (GRCm39) missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79,329,591 (GRCm39) missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79,298,937 (GRCm39) missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79,298,925 (GRCm39) missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79,334,535 (GRCm39) missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79,285,718 (GRCm39) missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79,325,237 (GRCm39) missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79,315,823 (GRCm39) missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79,333,032 (GRCm39) missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79,311,125 (GRCm39) missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79,286,744 (GRCm39) nonsense probably null
R1982:Zfyve26 UTSW 12 79,302,017 (GRCm39) missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79,330,806 (GRCm39) splice site probably null
R2071:Zfyve26 UTSW 12 79,334,220 (GRCm39) missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79,292,826 (GRCm39) missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79,292,861 (GRCm39) missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79,321,814 (GRCm39) missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79,330,890 (GRCm39) missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79,329,573 (GRCm39) splice site probably null
R3084:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R3086:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R4626:Zfyve26 UTSW 12 79,315,844 (GRCm39) missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79,291,170 (GRCm39) missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79,296,469 (GRCm39) splice site probably null
R4926:Zfyve26 UTSW 12 79,321,785 (GRCm39) missense probably benign
R4990:Zfyve26 UTSW 12 79,334,607 (GRCm39) missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79,327,159 (GRCm39) nonsense probably null
R5029:Zfyve26 UTSW 12 79,333,097 (GRCm39) missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79,302,135 (GRCm39) missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79,326,832 (GRCm39) nonsense probably null
R5252:Zfyve26 UTSW 12 79,315,756 (GRCm39) missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79,317,624 (GRCm39) missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79,293,295 (GRCm39) missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79,286,698 (GRCm39) missense possibly damaging 0.63
R5756:Zfyve26 UTSW 12 79,311,131 (GRCm39) missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79,334,511 (GRCm39) missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79,313,311 (GRCm39) missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79,340,628 (GRCm39) missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79,315,501 (GRCm39) missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79,296,373 (GRCm39) missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79,286,776 (GRCm39) missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79,285,109 (GRCm39) missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79,313,223 (GRCm39) missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79,330,926 (GRCm39) missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79,325,888 (GRCm39) missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79,327,179 (GRCm39) missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79,315,182 (GRCm39) missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79,292,945 (GRCm39) missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79,325,146 (GRCm39) splice site probably null
R7299:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79,297,942 (GRCm39) missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79,286,828 (GRCm39) missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79,334,581 (GRCm39) missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79,315,450 (GRCm39) missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79,337,731 (GRCm39) missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79,315,409 (GRCm39) missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79,327,129 (GRCm39) critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79,302,098 (GRCm39) missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79,315,331 (GRCm39) missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79,327,610 (GRCm39) missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79,307,605 (GRCm39) missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79,334,454 (GRCm39) missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79,334,227 (GRCm39) missense probably benign
R8758:Zfyve26 UTSW 12 79,311,083 (GRCm39) critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79,285,742 (GRCm39) missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79,334,152 (GRCm39) missense probably benign 0.05
R9067:Zfyve26 UTSW 12 79,318,915 (GRCm39) missense probably damaging 0.99
R9195:Zfyve26 UTSW 12 79,311,168 (GRCm39) missense probably benign 0.12
R9269:Zfyve26 UTSW 12 79,323,076 (GRCm39) missense possibly damaging 0.73
R9273:Zfyve26 UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
R9340:Zfyve26 UTSW 12 79,321,680 (GRCm39) nonsense probably null
R9348:Zfyve26 UTSW 12 79,315,231 (GRCm39) missense possibly damaging 0.81
R9482:Zfyve26 UTSW 12 79,291,239 (GRCm39) missense probably damaging 1.00
R9536:Zfyve26 UTSW 12 79,298,046 (GRCm39) missense probably benign 0.32
R9653:Zfyve26 UTSW 12 79,334,418 (GRCm39) missense probably benign
R9676:Zfyve26 UTSW 12 79,330,959 (GRCm39) missense probably benign 0.01
R9797:Zfyve26 UTSW 12 79,293,006 (GRCm39) missense probably damaging 0.98
RF010:Zfyve26 UTSW 12 79,302,112 (GRCm39) missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79,285,779 (GRCm39) missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79,315,307 (GRCm39) missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79,334,149 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGCTTAGCTGGAAACGG -3'
(R):5'- CAGGTAAGTTGCTTTACTCCGC -3'

Sequencing Primer
(F):5'- CAGCTCTAGAGGGCAGAACC -3'
(R):5'- GTTGCTTTACTCCGCCCCTTTG -3'
Posted On 2017-01-03