Incidental Mutation 'R5735:Adamts16'
ID 451671
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 043349-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5735 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70984337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 109 (D109Y)
Ref Sequence ENSEMBL: ENSMUSP00000122031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect possibly damaging
Transcript: ENSMUST00000080145
AA Change: D109Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: D109Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109694
AA Change: D109Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: D109Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123552
AA Change: D109Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: D109Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222495
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T A 9: 99,379,447 (GRCm39) probably null Het
Atg4b G T 1: 93,701,519 (GRCm39) G71V probably damaging Het
Atp10b A T 11: 43,042,601 (GRCm39) M54L probably benign Het
Baiap2l1 A G 5: 144,223,112 (GRCm39) L75P probably damaging Het
Bnc2 A C 4: 84,210,908 (GRCm39) L487R probably damaging Het
Cacng7 T C 7: 3,387,539 (GRCm39) S141P probably benign Het
Carmil2 G A 8: 106,424,663 (GRCm39) G1361D probably damaging Het
Cenpf T C 1: 189,386,560 (GRCm39) I1907V probably benign Het
Cep192 T C 18: 68,013,866 (GRCm39) V2422A probably benign Het
Cfap73 T A 5: 120,770,671 (GRCm39) Q33L probably benign Het
Cip2a T A 16: 48,837,856 (GRCm39) probably null Het
Cmtm2a A T 8: 105,019,418 (GRCm39) I57N probably damaging Het
Col6a2 T A 10: 76,435,727 (GRCm39) D836V probably benign Het
Dnah2 A G 11: 69,321,643 (GRCm39) V3839A possibly damaging Het
Enpp1 A T 10: 24,530,817 (GRCm39) F546L possibly damaging Het
Eps8l2 A G 7: 140,940,290 (GRCm39) T507A probably damaging Het
Erg28 C T 12: 85,862,926 (GRCm39) E129K probably benign Het
Erlec1 A T 11: 30,900,591 (GRCm39) N153K probably benign Het
Fam234a T C 17: 26,432,679 (GRCm39) E490G probably damaging Het
Fat4 C T 3: 39,003,725 (GRCm39) R1815C probably damaging Het
Galnt1 T G 18: 24,397,577 (GRCm39) I226S possibly damaging Het
Ifnl2 T A 7: 28,209,614 (GRCm39) I58F possibly damaging Het
Itih5 A G 2: 10,245,572 (GRCm39) N554D probably benign Het
Kcna10 A G 3: 107,102,394 (GRCm39) I342V probably benign Het
Kif6 G A 17: 50,139,210 (GRCm39) E561K probably damaging Het
Kl A G 5: 150,915,003 (GRCm39) N910S possibly damaging Het
Lpar2 G T 8: 70,276,385 (GRCm39) R58L probably damaging Het
Macrod2 A G 2: 140,260,809 (GRCm39) T27A possibly damaging Het
Mfsd2a A T 4: 122,843,120 (GRCm39) V387D probably damaging Het
Npas3 A T 12: 54,050,262 (GRCm39) T231S probably benign Het
Or4a70 A T 2: 89,323,812 (GRCm39) N281K probably damaging Het
Or52n5 A T 7: 104,587,966 (GRCm39) T78S probably benign Het
Or5aq1b A T 2: 86,901,756 (GRCm39) C241S probably damaging Het
Or8h10 A G 2: 86,809,044 (GRCm39) V32A probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pde10a A T 17: 9,160,024 (GRCm39) I432F probably damaging Het
Phka2 ACC AC X: 159,342,862 (GRCm39) probably null Het
Pomt1 G A 2: 32,133,517 (GRCm39) G218R probably damaging Het
Potefam1 A T 2: 111,055,837 (GRCm39) L183* probably null Het
Pramel22 A T 4: 143,381,205 (GRCm39) C273S probably damaging Het
Prdm5 C T 6: 65,904,974 (GRCm39) T157I possibly damaging Het
Psen2 T A 1: 180,068,491 (GRCm39) E54V probably benign Het
Ptpn13 C A 5: 103,702,686 (GRCm39) H1217Q probably benign Het
Ptprt A G 2: 161,376,484 (GRCm39) S1306P probably damaging Het
Ptpru G T 4: 131,565,401 (GRCm39) P23T probably benign Het
Rtn3 T C 19: 7,434,057 (GRCm39) E626G probably damaging Het
Scn3a A T 2: 65,312,622 (GRCm39) M1191K probably damaging Het
Scn3a T A 2: 65,314,803 (GRCm39) N1086I probably benign Het
Sgms2 A T 3: 131,129,866 (GRCm39) M174K probably damaging Het
Skor1 T A 9: 63,053,346 (GRCm39) I180F probably damaging Het
Slit2 T G 5: 48,416,958 (GRCm39) C1003W probably damaging Het
Tbc1d2b T A 9: 90,104,462 (GRCm39) Q560L possibly damaging Het
Themis A G 10: 28,598,530 (GRCm39) I51V probably benign Het
Tmem203 T C 2: 25,146,085 (GRCm39) V135A probably benign Het
Tns1 T C 1: 73,967,138 (GRCm39) T1212A probably benign Het
Trgv5 T G 13: 19,376,695 (GRCm39) H47Q probably benign Het
Trim2 G A 3: 84,075,029 (GRCm39) A697V probably damaging Het
Ubxn4 T C 1: 128,186,677 (GRCm39) S37P possibly damaging Het
Vmn2r17 A G 5: 109,600,716 (GRCm39) I671M possibly damaging Het
Vmn2r94 G T 17: 18,464,066 (GRCm39) S741R probably damaging Het
Vwce C A 19: 10,624,431 (GRCm39) D414E probably benign Het
Zfp397 T C 18: 24,093,249 (GRCm39) S245P possibly damaging Het
Zfp747l1 G T 7: 126,984,579 (GRCm39) H174Q possibly damaging Het
Zfp809 T A 9: 22,150,227 (GRCm39) Y241* probably null Het
Zfp995 C T 17: 22,101,010 (GRCm39) C29Y probably benign Het
Zfta A G 19: 7,400,161 (GRCm39) E209G probably benign Het
Zfyve26 T C 12: 79,320,147 (GRCm39) D1066G probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3842:Adamts16 UTSW 13 70,887,010 (GRCm39) missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70,877,017 (GRCm39) missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8231:Adamts16 UTSW 13 70,925,599 (GRCm39) missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70,941,217 (GRCm39) missense probably damaging 1.00
R8470:Adamts16 UTSW 13 70,984,496 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGTGCTATCTGTACTCACC -3'
(R):5'- GAGATCCTTCTCAGAACCCTG -3'

Sequencing Primer
(F):5'- GTGCTATCTGTACTCACCAAACC -3'
(R):5'- GAACCCTGAAATTACTCAGCCTCTTC -3'
Posted On 2017-01-03