Incidental Mutation 'R5735:Galnt1'
ID 451679
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Name polypeptide N-acetylgalactosaminyltransferase 1
Synonyms ppGaNTase-T1
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock # R5735 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 24205344-24286818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 24264520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 226 (I226S)
Ref Sequence ENSEMBL: ENSMUSP00000137427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000170243] [ENSMUST00000171583] [ENSMUST00000178605]
AlphaFold O08912
Predicted Effect possibly damaging
Transcript: ENSMUST00000000430
AA Change: I226S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: I226S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164066
SMART Domains Protein: ENSMUSP00000130238
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
PDB:2D7R|A 2 44 6e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000170243
AA Change: I226S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: I226S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171583
SMART Domains Protein: ENSMUSP00000131755
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178605
AA Change: I226S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: I226S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Tns1 T C 1: 73,927,979 T1212A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24267560 missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24280035 missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24264412 missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24269517 missense probably damaging 0.99
debonair UTSW 18 24271629 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24254525 missense probably benign 0.01
R1183:Galnt1 UTSW 18 24271590 missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24271774 splice site probably benign
R2349:Galnt1 UTSW 18 24280028 missense probably benign 0.03
R3739:Galnt1 UTSW 18 24271655 missense probably benign 0.27
R4223:Galnt1 UTSW 18 24238356 missense probably benign 0.27
R5001:Galnt1 UTSW 18 24271755 missense probably benign
R5410:Galnt1 UTSW 18 24267547 missense probably benign 0.02
R5516:Galnt1 UTSW 18 24280017 missense probably benign 0.00
R5685:Galnt1 UTSW 18 24264529 missense possibly damaging 0.81
R5687:Galnt1 UTSW 18 24272750 missense probably benign 0.00
R6106:Galnt1 UTSW 18 24254663 missense probably benign 0.31
R6222:Galnt1 UTSW 18 24264534 critical splice donor site probably null
R7448:Galnt1 UTSW 18 24284809 missense probably benign 0.00
R7489:Galnt1 UTSW 18 24282157 missense probably damaging 0.98
R8310:Galnt1 UTSW 18 24271629 missense probably damaging 1.00
R8408:Galnt1 UTSW 18 24267571 missense probably benign 0.44
R8884:Galnt1 UTSW 18 24267584 missense probably benign 0.00
R8989:Galnt1 UTSW 18 24269510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAGGAGCCTCACTTAGTGCTC -3'
(R):5'- ACTGCCAGACTTTAAGAAAGAAGTC -3'

Sequencing Primer
(F):5'- GAGCCTCACTTAGTGCTCTGTCAG -3'
(R):5'- AGAAGTCTTATCTGCATTTTGTTTGG -3'
Posted On 2017-01-03