Incidental Mutation 'R5736:Slc6a11'
ID451700
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 11
SynonymsGabt4, E130202I16Rik, Gat3, D930045G19Rik, GAT4
MMRRC Submission 043194-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5736 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location114131241-114249952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114162162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 244 (S244P)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
Predicted Effect probably damaging
Transcript: ENSMUST00000032451
AA Change: S244P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Mill2 A T 7: 18,858,249 Q265L probably benign Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prkag2 A T 5: 24,878,722 Y88N probably damaging Het
Prmt5 A C 14: 54,514,840 D166E probably null Het
Robo4 A T 9: 37,404,797 T366S possibly damaging Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114134868 missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114134892 missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114238396 missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114162139 missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114134987 missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114194609 critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114134665 missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114244890 missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114225811 splice site probably benign
R1226:Slc6a11 UTSW 6 114194663 missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114247666 missense probably benign
R2231:Slc6a11 UTSW 6 114194629 missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114131425 missense probably benign 0.37
R4384:Slc6a11 UTSW 6 114247727 missense possibly damaging 0.47
R4556:Slc6a11 UTSW 6 114244812 missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114131362 missense probably benign 0.00
R5488:Slc6a11 UTSW 6 114243894 missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114230051 missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114245618 missense probably benign 0.08
R6733:Slc6a11 UTSW 6 114134898 missense probably damaging 1.00
R7391:Slc6a11 UTSW 6 114238461 missense probably benign
R7451:Slc6a11 UTSW 6 114245683 nonsense probably null
R7750:Slc6a11 UTSW 6 114230137 missense possibly damaging 0.82
Z1177:Slc6a11 UTSW 6 114247642 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCTGGTAGAAGCACAATGGC -3'
(R):5'- TTAAAGCAGAGCAGAATAGCCC -3'

Sequencing Primer
(F):5'- GGTAGAAGCACAATGGCCATCTTC -3'
(R):5'- GCAGCTATGTGGAGGACCTC -3'
Posted On2017-01-03