Incidental Mutation 'R5736:Mill2'
ID451701
Institutional Source Beutler Lab
Gene Symbol Mill2
Ensembl Gene ENSMUSG00000040987
Gene NameMHC I like leukocyte 2
Synonyms
MMRRC Submission 043194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5736 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18839966-18865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18858249 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 265 (Q265L)
Ref Sequence ENSEMBL: ENSMUSP00000154268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]
Predicted Effect probably benign
Transcript: ENSMUST00000072386
AA Change: Q265L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987
AA Change: Q265L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I_3 39 224 2.5e-14 PFAM
Pfam:MHC_I 49 225 1.5e-33 PFAM
IGc1 244 316 7.82e-6 SMART
low complexity region 332 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072415
AA Change: Q250L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987
AA Change: Q250L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I 34 210 5.9e-33 PFAM
IGc1 229 301 7.82e-6 SMART
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207014
Predicted Effect probably benign
Transcript: ENSMUST00000227379
AA Change: Q250L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000228493
AA Change: Q265L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prkag2 A T 5: 24,878,722 Y88N probably damaging Het
Prmt5 A C 14: 54,514,840 D166E probably null Het
Robo4 A T 9: 37,404,797 T366S possibly damaging Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a11 T C 6: 114,162,162 S244P probably damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Mill2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Mill2 APN 7 18856640 missense probably damaging 0.98
IGL02465:Mill2 APN 7 18858243 nonsense probably null
IGL02876:Mill2 APN 7 18856507 missense probably damaging 1.00
R1725:Mill2 UTSW 7 18840068 missense probably benign 0.04
R1945:Mill2 UTSW 7 18841494 missense probably benign 0.00
R1964:Mill2 UTSW 7 18856604 missense probably damaging 1.00
R2260:Mill2 UTSW 7 18856488 missense probably benign 0.14
R3160:Mill2 UTSW 7 18856174 missense probably benign 0.32
R3162:Mill2 UTSW 7 18856174 missense probably benign 0.32
R4302:Mill2 UTSW 7 18856531 missense probably damaging 0.98
R4946:Mill2 UTSW 7 18856683 critical splice donor site probably null
R5121:Mill2 UTSW 7 18856666 missense probably benign 0.39
R5365:Mill2 UTSW 7 18858414 missense probably benign 0.01
R5557:Mill2 UTSW 7 18855959 nonsense probably null
R5998:Mill2 UTSW 7 18840064 missense probably benign 0.00
R6004:Mill2 UTSW 7 18856538 missense probably benign 0.32
R6016:Mill2 UTSW 7 18856448 missense probably benign 0.45
R6045:Mill2 UTSW 7 18856564 missense probably benign 0.01
R6534:Mill2 UTSW 7 18856596 missense possibly damaging 0.91
R6913:Mill2 UTSW 7 18856426 missense probably null 1.00
R7386:Mill2 UTSW 7 18858290 missense probably benign 0.16
Z1088:Mill2 UTSW 7 18856399 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGCATCACTGGAGCTG -3'
(R):5'- ACAGCTGTCTGCATGATGC -3'

Sequencing Primer
(F):5'- CATCACTGGAGCTGTGTGC -3'
(R):5'- CATGATGCTATGGTTGCCATGCC -3'
Posted On2017-01-03