Incidental Mutation 'R5736:Robo4'
ID451706
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 043194-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5736 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37404797 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 366 (T366S)
Ref Sequence ENSEMBL: ENSMUSP00000110698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102895
AA Change: T366S

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: T366S

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115046
AA Change: T366S

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: T366S

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115048
AA Change: T255S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: T255S

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect possibly damaging
Transcript: ENSMUST00000214185
AA Change: T366S

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Mill2 A T 7: 18,858,249 Q265L probably benign Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prkag2 A T 5: 24,878,722 Y88N probably damaging Het
Prmt5 A C 14: 54,514,840 D166E probably null Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a11 T C 6: 114,162,162 S244P probably damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37408281 missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37405834 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTCCTGTGTAGAGTGAAGC -3'
(R):5'- CTGACTAAGTAGGCCCTTGCTC -3'

Sequencing Primer
(F):5'- CAAACAGCTGTAAGAAGTGACTTTCC -3'
(R):5'- AAGTAGGCCCTTGCTCACTGC -3'
Posted On2017-01-03