Incidental Mutation 'R0551:Klkb1'
ID45171
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Namekallikrein B, plasma 1
SynonymsKlk3, Kal-3, PSA, Kal3
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45266689-45294859 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45277966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907] [ENSMUST00000026907]
Predicted Effect probably null
Transcript: ENSMUST00000026907
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably null
Transcript: ENSMUST00000026907
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45294068 splice site probably benign
IGL01756:Klkb1 APN 8 45272324 missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45276391 missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45276053 missense probably benign 0.00
IGL02128:Klkb1 APN 8 45287031 missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45276240 splice site probably benign
E0374:Klkb1 UTSW 8 45289091 missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45289196 splice site probably benign
R0149:Klkb1 UTSW 8 45276063 missense probably damaging 1.00
R0278:Klkb1 UTSW 8 45272409 missense probably benign 0.27
R1103:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R1931:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R2125:Klkb1 UTSW 8 45275504 missense possibly damaging 0.68
R2418:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R2419:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45282801 missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45277055 missense probably benign 0.11
R4461:Klkb1 UTSW 8 45273575 missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45282777 missense probably benign 0.43
R4974:Klkb1 UTSW 8 45286958 missense probably damaging 1.00
R5113:Klkb1 UTSW 8 45270697 missense probably benign 0.00
R5117:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45270711 missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45270666 missense probably benign 0.13
R6230:Klkb1 UTSW 8 45283215 missense probably benign 0.03
R6554:Klkb1 UTSW 8 45273554 missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45273634 missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45275538 missense probably benign 0.00
R7497:Klkb1 UTSW 8 45294790 utr 3 prime probably benign
R7599:Klkb1 UTSW 8 45278113 missense probably benign 0.01
R7867:Klkb1 UTSW 8 45286965 missense probably damaging 1.00
R7950:Klkb1 UTSW 8 45286965 missense probably damaging 1.00
Z1176:Klkb1 UTSW 8 45273629 missense probably damaging 0.99
Z1177:Klkb1 UTSW 8 45275472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTGAGAATGCTTCCTGC -3'
(R):5'- AGGGTGCTGATTCCCGCCAATATC -3'

Sequencing Primer
(F):5'- CCGCTGTGGTTTGACTAAATAG -3'
(R):5'- AAACTCGGGCATTGTGTCAC -3'
Posted On2013-06-11