Incidental Mutation 'R5736:Otx1'
ID451710
Institutional Source Beutler Lab
Gene Symbol Otx1
Ensembl Gene ENSMUSG00000005917
Gene Nameorthodenticle homeobox 1
SynonymsA730044F23Rik, jv
MMRRC Submission 043194-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R5736 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21994764-22002897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21997037 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 91 (A91S)
Ref Sequence ENSEMBL: ENSMUSP00000134704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]
Predicted Effect probably damaging
Transcript: ENSMUST00000006071
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
Pfam:TF_Otx 178 279 2.5e-39 PFAM
internal_repeat_1 310 322 1.39e-7 PROSPERO
low complexity region 324 331 N/A INTRINSIC
internal_repeat_1 334 346 1.39e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000147486
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172395
Meta Mutation Damage Score 0.4867 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Mill2 A T 7: 18,858,249 Q265L probably benign Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prkag2 A T 5: 24,878,722 Y88N probably damaging Het
Prmt5 A C 14: 54,514,840 D166E probably null Het
Robo4 A T 9: 37,404,797 T366S possibly damaging Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a11 T C 6: 114,162,162 S244P probably damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Otx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Otx1 APN 11 21996794 unclassified probably benign
Embarrassed UTSW 11 21997037 missense probably damaging 1.00
R1946:Otx1 UTSW 11 21998482 missense probably damaging 1.00
R2291:Otx1 UTSW 11 21996634 unclassified probably benign
R2870:Otx1 UTSW 11 21998681 intron probably benign
R4164:Otx1 UTSW 11 21996638 unclassified probably benign
R4845:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4925:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4934:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4993:Otx1 UTSW 11 21998532 splice site probably null
R5061:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5062:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5063:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5068:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5069:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5070:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5097:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5169:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5170:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5171:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5172:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5198:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5199:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5200:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5201:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5202:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5203:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5204:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5205:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5256:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5267:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5360:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5361:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5363:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5372:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5375:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5380:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5381:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5382:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5383:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5415:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5416:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5534:Otx1 UTSW 11 21996296 unclassified probably benign
R5592:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5594:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5725:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5727:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5735:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5841:Otx1 UTSW 11 21998594 intron probably benign
R5940:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5941:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6080:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6081:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6093:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6126:Otx1 UTSW 11 21996457 unclassified probably benign
R6131:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6132:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6134:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6187:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6220:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6269:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6270:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6271:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6272:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6396:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6619:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6624:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6680:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6681:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6718:Otx1 UTSW 11 21996412 unclassified probably benign
R6831:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6834:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6985:Otx1 UTSW 11 21996615 nonsense probably null
R7631:Otx1 UTSW 11 21999458 nonsense probably null
R8100:Otx1 UTSW 11 21999392 missense probably benign 0.16
X0054:Otx1 UTSW 11 21996331 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGATGGACGAAGCAGTAG -3'
(R):5'- TACTAGGGGTTTGCGCAGAAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGACGCTGCTG -3'
(R):5'- TTTGCGCAGAAGGATGGG -3'
Posted On2017-01-03