Incidental Mutation 'R5702:Mettl13'
ID451730
Institutional Source Beutler Lab
Gene Symbol Mettl13
Ensembl Gene ENSMUSG00000026694
Gene Namemethyltransferase like 13
Synonyms5630401D24Rik
MMRRC Submission 043182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5702 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162532127-162548551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162545980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000028017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028017] [ENSMUST00000159316] [ENSMUST00000159817] [ENSMUST00000176220]
Predicted Effect probably benign
Transcript: ENSMUST00000028017
AA Change: V234A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028017
Gene: ENSMUSG00000026694
AA Change: V234A

DomainStartEndE-ValueType
Pfam:TPMT 13 172 1e-7 PFAM
Pfam:Ubie_methyltran 38 190 6.6e-7 PFAM
Pfam:Methyltransf_31 46 198 5.3e-13 PFAM
Pfam:Methyltransf_18 48 161 1.1e-10 PFAM
Pfam:Methyltransf_25 52 154 3.7e-9 PFAM
Pfam:Methyltransf_11 53 158 4.1e-16 PFAM
low complexity region 436 452 N/A INTRINSIC
Pfam:Spermine_synth 472 630 7.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159255
Predicted Effect probably benign
Transcript: ENSMUST00000159316
SMART Domains Protein: ENSMUSP00000135822
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Methyltransf_25 1 101 2.7e-10 PFAM
Pfam:Methyltransf_18 1 102 8e-11 PFAM
Pfam:Methyltransf_31 1 149 1.9e-12 PFAM
Pfam:Methyltransf_11 2 100 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159817
SMART Domains Protein: ENSMUSP00000124267
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:TPMT 13 144 4.6e-8 PFAM
Pfam:Methyltransf_31 46 195 3.5e-12 PFAM
Pfam:Methyltransf_18 48 160 5e-11 PFAM
Pfam:Methyltransf_25 52 154 1.1e-9 PFAM
Pfam:Methyltransf_11 53 158 6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161760
Predicted Effect probably benign
Transcript: ENSMUST00000176220
SMART Domains Protein: ENSMUSP00000135879
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Spermine_synth 73 239 1.8e-8 PFAM
Pfam:Methyltransf_18 126 234 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195027
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,343,688 probably null Het
Abcb1a G A 5: 8,737,752 S1018N probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
AF529169 G A 9: 89,591,155 A901V probably benign Het
Ahnak G T 19: 9,001,840 V163L probably damaging Het
Atf6b T C 17: 34,651,004 I288T possibly damaging Het
Blm A T 7: 80,458,927 V1323E probably benign Het
Brap T A 5: 121,665,143 L118Q probably damaging Het
C1qbp G A 11: 70,978,744 T171I probably benign Het
Ccdc136 C A 6: 29,412,982 H455Q probably damaging Het
Chd3 A T 11: 69,361,435 V47D possibly damaging Het
Cnot10 A C 9: 114,629,010 F143V probably damaging Het
Cnot8 T C 11: 58,114,047 S191P possibly damaging Het
Coro2b G A 9: 62,426,577 T345I probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dnah11 C A 12: 118,113,907 A1284S probably benign Het
Dock4 G A 12: 40,737,491 D802N probably benign Het
Dsg1a T C 18: 20,336,865 probably null Het
Elp3 C T 14: 65,577,982 R187Q probably damaging Het
Ercc3 G A 18: 32,254,153 R473Q probably damaging Het
F5 G A 1: 164,194,547 W1530* probably null Het
Fmnl1 T C 11: 103,185,665 I219T probably damaging Het
Gemin4 G A 11: 76,210,837 R1033C probably benign Het
Gm2381 T A 7: 42,822,396 I20F probably benign Het
Hmgcll1 A G 9: 76,084,390 M129V possibly damaging Het
Ltbp3 G T 19: 5,747,821 R496L probably benign Het
Olfr350 A G 2: 36,850,934 D296G probably damaging Het
Pde7a A T 3: 19,241,207 C146* probably null Het
Pla2g4e T A 2: 120,188,511 N202Y possibly damaging Het
Plk5 G A 10: 80,360,567 probably null Het
Ptpn7 A G 1: 135,133,844 T15A probably benign Het
Rrn3 T A 16: 13,813,266 Y655* probably null Het
Scarb2 C T 5: 92,451,396 G355D probably damaging Het
Scd2 G A 19: 44,298,063 A111T possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Smurf1 T C 5: 144,901,211 T57A possibly damaging Het
Spire2 C T 8: 123,346,663 P94S probably benign Het
Tex2 T C 11: 106,544,395 H237R possibly damaging Het
Vmn2r109 T C 17: 20,554,145 D316G probably benign Het
Zfp830 T A 11: 82,764,974 F201L possibly damaging Het
Zic1 A G 9: 91,364,080 F313S probably damaging Het
Other mutations in Mettl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mettl13 APN 1 162535865 missense possibly damaging 0.74
IGL00589:Mettl13 APN 1 162542391 missense probably damaging 1.00
IGL01765:Mettl13 APN 1 162538953 missense probably benign
IGL02200:Mettl13 APN 1 162538823 intron probably benign
IGL02835:Mettl13 UTSW 1 162546016 missense probably damaging 0.97
R0055:Mettl13 UTSW 1 162546181 missense probably damaging 1.00
R0322:Mettl13 UTSW 1 162544176 splice site probably benign
R0390:Mettl13 UTSW 1 162538889 missense possibly damaging 0.51
R0423:Mettl13 UTSW 1 162544385 missense probably damaging 1.00
R0723:Mettl13 UTSW 1 162534430 missense probably damaging 1.00
R1472:Mettl13 UTSW 1 162537167 missense possibly damaging 0.95
R2429:Mettl13 UTSW 1 162546325 nonsense probably null
R3755:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R3756:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R4058:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4059:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4087:Mettl13 UTSW 1 162548202 missense possibly damaging 0.53
R4885:Mettl13 UTSW 1 162537268 missense probably damaging 0.99
R4974:Mettl13 UTSW 1 162537220 missense probably damaging 0.99
R5070:Mettl13 UTSW 1 162545899 missense possibly damaging 0.47
R5447:Mettl13 UTSW 1 162535880 missense probably benign 0.01
R6137:Mettl13 UTSW 1 162535886 missense probably benign 0.09
R6570:Mettl13 UTSW 1 162544286 missense probably damaging 0.99
R6754:Mettl13 UTSW 1 162548123 missense probably damaging 1.00
R7340:Mettl13 UTSW 1 162538978 missense probably benign 0.00
R7386:Mettl13 UTSW 1 162548154 missense probably damaging 1.00
R8397:Mettl13 UTSW 1 162544318 missense possibly damaging 0.78
R8557:Mettl13 UTSW 1 162544352 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAAAATGATTGTCCCGCGATG -3'
(R):5'- GAAGAAAGCAGTGGGCCACTTC -3'

Sequencing Primer
(F):5'- AAAATGATTGTCCCGCGATGGTTTC -3'
(R):5'- AGTGGGCCACTTCTCTCG -3'
Posted On2017-01-03