Incidental Mutation 'R5702:Gm2381'
ID451740
Institutional Source Beutler Lab
Gene Symbol Gm2381
Ensembl Gene ENSMUSG00000092225
Gene Namepredicted gene 2381
Synonyms
MMRRC Submission 043182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5702 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42816829-42867234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42822396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 20 (I20F)
Ref Sequence ENSEMBL: ENSMUSP00000133949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174558]
Predicted Effect probably benign
Transcript: ENSMUST00000174558
AA Change: I20F

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133949
Gene: ENSMUSG00000092225
AA Change: I20F

DomainStartEndE-ValueType
Blast:KRAB 1 34 1e-15 BLAST
ZnF_C2H2 99 121 5.5e-3 SMART
ZnF_C2H2 127 149 5.9e-3 SMART
ZnF_C2H2 155 177 7.37e-4 SMART
ZnF_C2H2 183 205 2.75e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 3.34e-2 SMART
ZnF_C2H2 267 289 1.58e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,343,688 probably null Het
Abcb1a G A 5: 8,737,752 S1018N probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
AF529169 G A 9: 89,591,155 A901V probably benign Het
Ahnak G T 19: 9,001,840 V163L probably damaging Het
Atf6b T C 17: 34,651,004 I288T possibly damaging Het
Blm A T 7: 80,458,927 V1323E probably benign Het
Brap T A 5: 121,665,143 L118Q probably damaging Het
C1qbp G A 11: 70,978,744 T171I probably benign Het
Ccdc136 C A 6: 29,412,982 H455Q probably damaging Het
Chd3 A T 11: 69,361,435 V47D possibly damaging Het
Cnot10 A C 9: 114,629,010 F143V probably damaging Het
Cnot8 T C 11: 58,114,047 S191P possibly damaging Het
Coro2b G A 9: 62,426,577 T345I probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dnah11 C A 12: 118,113,907 A1284S probably benign Het
Dock4 G A 12: 40,737,491 D802N probably benign Het
Dsg1a T C 18: 20,336,865 probably null Het
Elp3 C T 14: 65,577,982 R187Q probably damaging Het
Ercc3 G A 18: 32,254,153 R473Q probably damaging Het
F5 G A 1: 164,194,547 W1530* probably null Het
Fmnl1 T C 11: 103,185,665 I219T probably damaging Het
Gemin4 G A 11: 76,210,837 R1033C probably benign Het
Hmgcll1 A G 9: 76,084,390 M129V possibly damaging Het
Ltbp3 G T 19: 5,747,821 R496L probably benign Het
Mettl13 A G 1: 162,545,980 V234A probably benign Het
Olfr350 A G 2: 36,850,934 D296G probably damaging Het
Pde7a A T 3: 19,241,207 C146* probably null Het
Pla2g4e T A 2: 120,188,511 N202Y possibly damaging Het
Plk5 G A 10: 80,360,567 probably null Het
Ptpn7 A G 1: 135,133,844 T15A probably benign Het
Rrn3 T A 16: 13,813,266 Y655* probably null Het
Scarb2 C T 5: 92,451,396 G355D probably damaging Het
Scd2 G A 19: 44,298,063 A111T possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Smurf1 T C 5: 144,901,211 T57A possibly damaging Het
Spire2 C T 8: 123,346,663 P94S probably benign Het
Tex2 T C 11: 106,544,395 H237R possibly damaging Het
Vmn2r109 T C 17: 20,554,145 D316G probably benign Het
Zfp830 T A 11: 82,764,974 F201L possibly damaging Het
Zic1 A G 9: 91,364,080 F313S probably damaging Het
Other mutations in Gm2381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Gm2381 APN 7 42822609 splice site probably benign
R0266:Gm2381 UTSW 7 42819948 nonsense probably null
R0617:Gm2381 UTSW 7 42819978 missense probably damaging 1.00
R0650:Gm2381 UTSW 7 42820080 missense probably damaging 0.98
R0849:Gm2381 UTSW 7 42819948 nonsense probably null
R1340:Gm2381 UTSW 7 42820404 missense possibly damaging 0.76
R1549:Gm2381 UTSW 7 42822401 missense probably benign 0.09
R1702:Gm2381 UTSW 7 42820231 missense probably benign 0.08
R1708:Gm2381 UTSW 7 42820225 missense probably benign 0.05
R1909:Gm2381 UTSW 7 42819928 missense probably damaging 1.00
R2848:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R2849:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R4437:Gm2381 UTSW 7 42819844 missense probably damaging 1.00
R5445:Gm2381 UTSW 7 42820001 missense probably damaging 0.96
R6370:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6371:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6372:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6688:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R7150:Gm2381 UTSW 7 42820464 missense probably benign 0.04
R7336:Gm2381 UTSW 7 42822380 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTACAACAACCTATCAGCTGCCT -3'
(R):5'- TCACTATCACACTTTGTGTTGTACAC -3'

Sequencing Primer
(F):5'- TATCAGCTGCCTGGAATCAAGGTAC -3'
(R):5'- TGCATGTACACTTCACTCGGGAG -3'
Posted On2017-01-03