Incidental Mutation 'R5702:Coro2b'
ID451746
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 043182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5702 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62426577 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 345 (T345I)
Ref Sequence ENSEMBL: ENSMUSP00000041826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000174439]
Predicted Effect probably damaging
Transcript: ENSMUST00000048043
AA Change: T345I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: T345I

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131981
AA Change: T44I
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729
AA Change: T44I

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect probably benign
Transcript: ENSMUST00000164246
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174439
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,343,688 probably null Het
Abcb1a G A 5: 8,737,752 S1018N probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
AF529169 G A 9: 89,591,155 A901V probably benign Het
Ahnak G T 19: 9,001,840 V163L probably damaging Het
Atf6b T C 17: 34,651,004 I288T possibly damaging Het
Blm A T 7: 80,458,927 V1323E probably benign Het
Brap T A 5: 121,665,143 L118Q probably damaging Het
C1qbp G A 11: 70,978,744 T171I probably benign Het
Ccdc136 C A 6: 29,412,982 H455Q probably damaging Het
Chd3 A T 11: 69,361,435 V47D possibly damaging Het
Cnot10 A C 9: 114,629,010 F143V probably damaging Het
Cnot8 T C 11: 58,114,047 S191P possibly damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dnah11 C A 12: 118,113,907 A1284S probably benign Het
Dock4 G A 12: 40,737,491 D802N probably benign Het
Dsg1a T C 18: 20,336,865 probably null Het
Elp3 C T 14: 65,577,982 R187Q probably damaging Het
Ercc3 G A 18: 32,254,153 R473Q probably damaging Het
F5 G A 1: 164,194,547 W1530* probably null Het
Fmnl1 T C 11: 103,185,665 I219T probably damaging Het
Gemin4 G A 11: 76,210,837 R1033C probably benign Het
Gm2381 T A 7: 42,822,396 I20F probably benign Het
Hmgcll1 A G 9: 76,084,390 M129V possibly damaging Het
Ltbp3 G T 19: 5,747,821 R496L probably benign Het
Mettl13 A G 1: 162,545,980 V234A probably benign Het
Olfr350 A G 2: 36,850,934 D296G probably damaging Het
Pde7a A T 3: 19,241,207 C146* probably null Het
Pla2g4e T A 2: 120,188,511 N202Y possibly damaging Het
Plk5 G A 10: 80,360,567 probably null Het
Ptpn7 A G 1: 135,133,844 T15A probably benign Het
Rrn3 T A 16: 13,813,266 Y655* probably null Het
Scarb2 C T 5: 92,451,396 G355D probably damaging Het
Scd2 G A 19: 44,298,063 A111T possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Smurf1 T C 5: 144,901,211 T57A possibly damaging Het
Spire2 C T 8: 123,346,663 P94S probably benign Het
Tex2 T C 11: 106,544,395 H237R possibly damaging Het
Vmn2r109 T C 17: 20,554,145 D316G probably benign Het
Zfp830 T A 11: 82,764,974 F201L possibly damaging Het
Zic1 A G 9: 91,364,080 F313S probably damaging Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
PIT4151001:Coro2b UTSW 9 62429004 missense probably damaging 1.00
R0422:Coro2b UTSW 9 62427977 missense probably benign 0.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62427981 missense probably benign 0.08
R1115:Coro2b UTSW 9 62431327 missense probably damaging 0.96
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1422:Coro2b UTSW 9 62428947 critical splice donor site probably null
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 splice site probably null
R3971:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense possibly damaging 0.81
R7347:Coro2b UTSW 9 62489372 missense probably benign
R8199:Coro2b UTSW 9 62429020 missense probably benign 0.00
R8447:Coro2b UTSW 9 62426560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTACCTGAGAGTGTCCTC -3'
(R):5'- ACTATCATCAGTCAGAGGCCG -3'

Sequencing Primer
(F):5'- TGAGAGTGTCCTCCGCCC -3'
(R):5'- GAGGCCGACTCAAGACATCATG -3'
Posted On2017-01-03