Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Arhgap20'

45175

Institutional Source

Beutler Lab

Gene Symbol

Arhgap20

Ensembl Gene

ENSMUSG00000053199

Gene Name

Rho GTPase activating protein 20

Synonyms

6530403F17Rik, A530023E23Rik

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.419) question?

Stock #

R0551 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

51765337-51853856 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 51825825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]

AlphaFold

Q6IFT4

Predicted Effect

probably benign
Transcript: ENSMUST00000065496

SMART Domains

Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199

Domain	Start	End	E-Value	Type
PH	86	187	3.31e-5	SMART
Pfam:RA	194	283	3.6e-15	PFAM
RhoGAP	374	548	1.27e-41	SMART
internal_repeat_1	655	779	9.97e-15	PROSPERO
internal_repeat_1	797	922	9.97e-15	PROSPERO
low complexity region	935	962	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126567

Predicted Effect

probably benign
Transcript: ENSMUST00000130405

SMART Domains

Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199

Domain	Start	End	E-Value	Type
PH	50	151	3.31e-5	SMART
Pfam:RA	158	247	3.3e-14	PFAM
RhoGAP	338	512	1.27e-41	SMART
internal_repeat_1	619	743	7.07e-15	PROSPERO
internal_repeat_1	761	886	7.07e-15	PROSPERO
low complexity region	899	926	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146509

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Arhgap20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Arhgap20	APN	9	51849413	missense	probably benign	0.00
IGL01542:Arhgap20	APN	9	51838887	missense	probably benign
IGL01815:Arhgap20	APN	9	51846168	missense	probably damaging	1.00
IGL01975:Arhgap20	APN	9	51849797	nonsense	probably null
IGL02041:Arhgap20	APN	9	51846190	missense	possibly damaging	0.92
IGL02557:Arhgap20	APN	9	51821273	missense	probably damaging	1.00
IGL02602:Arhgap20	APN	9	51825843	missense	probably damaging	1.00
IGL02741:Arhgap20	APN	9	51848645	missense	probably benign	0.17
IGL02792:Arhgap20	APN	9	51849918	missense	possibly damaging	0.89
IGL03166:Arhgap20	APN	9	51849777	missense	possibly damaging	0.63
P0047:Arhgap20	UTSW	9	51849236	missense	probably damaging	1.00
R0115:Arhgap20	UTSW	9	51838972	missense	probably damaging	1.00
R0121:Arhgap20	UTSW	9	51838951	missense	possibly damaging	0.91
R0539:Arhgap20	UTSW	9	51850155	missense	probably benign	0.01
R0541:Arhgap20	UTSW	9	51849663	missense	probably damaging	1.00
R0570:Arhgap20	UTSW	9	51840451	missense	possibly damaging	0.56
R0630:Arhgap20	UTSW	9	51849384	missense	probably damaging	0.98
R0931:Arhgap20	UTSW	9	51816741	missense	probably benign	0.30
R0992:Arhgap20	UTSW	9	51816786	missense	probably damaging	0.96
R1052:Arhgap20	UTSW	9	51846270	missense	probably damaging	0.98
R1779:Arhgap20	UTSW	9	51849915	missense	probably benign
R1839:Arhgap20	UTSW	9	51849326	missense	probably damaging	0.99
R1942:Arhgap20	UTSW	9	51831698	missense	probably benign	0.43
R2292:Arhgap20	UTSW	9	51849443	missense	possibly damaging	0.63
R3896:Arhgap20	UTSW	9	51816837	missense	probably damaging	0.96
R4109:Arhgap20	UTSW	9	51816685	missense	possibly damaging	0.60
R4166:Arhgap20	UTSW	9	51826835	critical splice acceptor site	probably null
R4631:Arhgap20	UTSW	9	51840353	intron	probably benign
R4692:Arhgap20	UTSW	9	51785788	missense	probably damaging	1.00
R5273:Arhgap20	UTSW	9	51848616	missense	probably damaging	1.00
R5505:Arhgap20	UTSW	9	51838948	missense	probably damaging	0.98
R5743:Arhgap20	UTSW	9	51816727	missense	probably benign	0.17
R5847:Arhgap20	UTSW	9	51824976	intron	probably benign
R6006:Arhgap20	UTSW	9	51850126	missense	probably benign
R6112:Arhgap20	UTSW	9	51829384	missense	probably damaging	1.00
R6355:Arhgap20	UTSW	9	51843720	missense	probably damaging	1.00
R6576:Arhgap20	UTSW	9	51849278	missense	probably benign	0.03
R6801:Arhgap20	UTSW	9	51848592	missense	probably damaging	1.00
R7130:Arhgap20	UTSW	9	51849747	missense	probably damaging	0.98
R7318:Arhgap20	UTSW	9	51840502	missense	probably benign
R7347:Arhgap20	UTSW	9	51849035	missense	probably benign	0.07
R7500:Arhgap20	UTSW	9	51840502	missense	probably benign
R7598:Arhgap20	UTSW	9	51849790	missense	possibly damaging	0.95
R7677:Arhgap20	UTSW	9	51840398	missense	probably damaging	0.97
R7725:Arhgap20	UTSW	9	51831750	missense	possibly damaging	0.80
R8086:Arhgap20	UTSW	9	51849263	missense	probably benign	0.00
R8122:Arhgap20	UTSW	9	51849993	missense	probably damaging	0.99
R8125:Arhgap20	UTSW	9	51826909	missense	probably damaging	0.99
R8196:Arhgap20	UTSW	9	51848977	missense	possibly damaging	0.94
R8783:Arhgap20	UTSW	9	51816667	splice site	probably benign
R8972:Arhgap20	UTSW	9	51849011	missense	probably benign	0.03
R9027:Arhgap20	UTSW	9	51843677	missense	probably damaging	1.00
R9427:Arhgap20	UTSW	9	51843691	missense	probably damaging	1.00
R9564:Arhgap20	UTSW	9	51850113	frame shift	probably null
R9741:Arhgap20	UTSW	9	51849430	nonsense	probably null
Z1177:Arhgap20	UTSW	9	51824924	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACCATGCTTAGCAGCTAAATGGG -3'
(R):5'- AGGACACACGCACAGTCTTTCAG -3'

Sequencing Primer
(F):5'- GGCGAGTTCCATGCCTAATATC -3'
(R):5'- GCACAGTCTTTCAGCCTGC -3'

Posted On

2013-06-11