Incidental Mutation 'R5702:Fmnl1'
ID451760
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Nameformin-like 1
Synonymsformin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 043182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5702 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103171107-103198901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103185665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 219 (I219T)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
Predicted Effect probably damaging
Transcript: ENSMUST00000042286
AA Change: I219T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: I219T

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107027
AA Change: I219T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: I219T

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect possibly damaging
Transcript: ENSMUST00000218163
AA Change: I225T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,343,688 probably null Het
Abcb1a G A 5: 8,737,752 S1018N probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
AF529169 G A 9: 89,591,155 A901V probably benign Het
Ahnak G T 19: 9,001,840 V163L probably damaging Het
Atf6b T C 17: 34,651,004 I288T possibly damaging Het
Blm A T 7: 80,458,927 V1323E probably benign Het
Brap T A 5: 121,665,143 L118Q probably damaging Het
C1qbp G A 11: 70,978,744 T171I probably benign Het
Ccdc136 C A 6: 29,412,982 H455Q probably damaging Het
Chd3 A T 11: 69,361,435 V47D possibly damaging Het
Cnot10 A C 9: 114,629,010 F143V probably damaging Het
Cnot8 T C 11: 58,114,047 S191P possibly damaging Het
Coro2b G A 9: 62,426,577 T345I probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dnah11 C A 12: 118,113,907 A1284S probably benign Het
Dock4 G A 12: 40,737,491 D802N probably benign Het
Dsg1a T C 18: 20,336,865 probably null Het
Elp3 C T 14: 65,577,982 R187Q probably damaging Het
Ercc3 G A 18: 32,254,153 R473Q probably damaging Het
F5 G A 1: 164,194,547 W1530* probably null Het
Gemin4 G A 11: 76,210,837 R1033C probably benign Het
Gm2381 T A 7: 42,822,396 I20F probably benign Het
Hmgcll1 A G 9: 76,084,390 M129V possibly damaging Het
Ltbp3 G T 19: 5,747,821 R496L probably benign Het
Mettl13 A G 1: 162,545,980 V234A probably benign Het
Olfr350 A G 2: 36,850,934 D296G probably damaging Het
Pde7a A T 3: 19,241,207 C146* probably null Het
Pla2g4e T A 2: 120,188,511 N202Y possibly damaging Het
Plk5 G A 10: 80,360,567 probably null Het
Ptpn7 A G 1: 135,133,844 T15A probably benign Het
Rrn3 T A 16: 13,813,266 Y655* probably null Het
Scarb2 C T 5: 92,451,396 G355D probably damaging Het
Scd2 G A 19: 44,298,063 A111T possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Smurf1 T C 5: 144,901,211 T57A possibly damaging Het
Spire2 C T 8: 123,346,663 P94S probably benign Het
Tex2 T C 11: 106,544,395 H237R possibly damaging Het
Vmn2r109 T C 17: 20,554,145 D316G probably benign Het
Zfp830 T A 11: 82,764,974 F201L possibly damaging Het
Zic1 A G 9: 91,364,080 F313S probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCAGCTTAGAGTTCCTAG -3'
(R):5'- AATCAAACCCAGGGCTTTCC -3'

Sequencing Primer
(F):5'- GCAGCTTAGAGTTCCTAGATCGATC -3'
(R):5'- CAGGCTCGTAGGGTTCCAG -3'
Posted On2017-01-03