Incidental Mutation 'R5703:Zc3h6'
ID451781
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 043183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5703 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 128993452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
Predicted Effect unknown
Transcript: ENSMUST00000110319
AA Change: D137G
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851
AA Change: D137G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110320
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,420,559 N605I probably damaging Het
AI314180 A T 4: 58,877,171 probably null Het
Btd C T 14: 31,667,047 R242* probably null Het
Cdc42bpg A G 19: 6,322,673 D1502G possibly damaging Het
Chst2 A G 9: 95,404,932 F454L probably damaging Het
Col16a1 G A 4: 130,053,299 A146T probably damaging Het
Cyp3a11 A T 5: 145,860,373 S399T probably benign Het
Dspp C T 5: 104,177,051 H427Y possibly damaging Het
Dtx4 A T 19: 12,482,210 M410K possibly damaging Het
Epb41l2 C T 10: 25,441,767 R61W probably damaging Het
Fam126a A T 5: 23,980,579 probably null Het
Gbp6 T C 5: 105,273,281 K553E probably benign Het
Git1 CCG C 11: 77,504,668 probably null Het
Gm13199 C T 2: 5,862,448 probably benign Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
Hoxa2 G T 6: 52,163,263 Q248K probably damaging Het
Krt33b T C 11: 100,025,548 T228A probably benign Het
Loxhd1 A G 18: 77,356,877 E324G probably damaging Het
Map3k20 A G 2: 72,402,170 N390S probably benign Het
Mroh7 A G 4: 106,708,560 Y126H possibly damaging Het
Muc4 G A 16: 32,736,241 W15* probably null Het
Ndrg2 T A 14: 51,910,122 probably null Het
Ntsr1 T C 2: 180,500,433 S6P probably damaging Het
Olfr1023 T C 2: 85,887,439 I213T probably benign Het
Olfr495 G A 7: 108,395,500 V127I probably benign Het
Pcdhb6 A T 18: 37,334,700 T225S probably benign Het
Rfng C A 11: 120,782,016 V294L probably benign Het
Scml4 C T 10: 42,865,570 probably benign Het
Slc5a2 A G 7: 128,270,615 I407V possibly damaging Het
Strc T C 2: 121,370,814 T1267A probably benign Het
Tanc1 T C 2: 59,795,997 V566A probably damaging Het
Tas1r2 T C 4: 139,667,336 S468P probably damaging Het
Tenm2 T A 11: 36,023,799 T2304S probably benign Het
Tirap A T 9: 35,188,758 L210Q probably damaging Het
Vav3 A T 3: 109,341,241 Q68L probably benign Het
Vmn2r54 C T 7: 12,629,667 S433N probably benign Het
Wars A T 12: 108,875,121 Y244N probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTACAGGGATTATGATGTTCC -3'
(R):5'- ATGAATGCCCTTGGACACTC -3'

Sequencing Primer
(F):5'- CAGGGATTATGATGTTCCATTTTCTC -3'
(R):5'- TCTATGGAAAACAGCCTGGAGTTCC -3'
Posted On2017-01-03