Incidental Mutation 'R5703:Zc3h6'
ID 451781
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 043183-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R5703 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 128835372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000110319
AA Change: D137G
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851
AA Change: D137G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110320
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,459,640 (GRCm39) N605I probably damaging Het
Btd C T 14: 31,389,004 (GRCm39) R242* probably null Het
Cdc42bpg A G 19: 6,372,703 (GRCm39) D1502G possibly damaging Het
Chst2 A G 9: 95,286,985 (GRCm39) F454L probably damaging Het
Col16a1 G A 4: 129,947,092 (GRCm39) A146T probably damaging Het
Cyp3a11 A T 5: 145,797,183 (GRCm39) S399T probably benign Het
Dspp C T 5: 104,324,917 (GRCm39) H427Y possibly damaging Het
Dtx4 A T 19: 12,459,574 (GRCm39) M410K possibly damaging Het
Ecpas A T 4: 58,877,171 (GRCm39) probably null Het
Epb41l2 C T 10: 25,317,665 (GRCm39) R61W probably damaging Het
Gbp6 T C 5: 105,421,147 (GRCm39) K553E probably benign Het
Git1 CCG C 11: 77,395,494 (GRCm39) probably null Het
Gm13199 C T 2: 5,867,259 (GRCm39) probably benign Het
Gramd2a G A 9: 59,615,299 (GRCm39) G13R probably benign Het
Hoxa2 G T 6: 52,140,243 (GRCm39) Q248K probably damaging Het
Hycc1 A T 5: 24,185,577 (GRCm39) probably null Het
Krt33b T C 11: 99,916,374 (GRCm39) T228A probably benign Het
Loxhd1 A G 18: 77,444,573 (GRCm39) E324G probably damaging Het
Map3k20 A G 2: 72,232,514 (GRCm39) N390S probably benign Het
Mroh7 A G 4: 106,565,757 (GRCm39) Y126H possibly damaging Het
Muc4 G A 16: 32,555,059 (GRCm39) W15* probably null Het
Ndrg2 T A 14: 52,147,579 (GRCm39) probably null Het
Ntsr1 T C 2: 180,142,226 (GRCm39) S6P probably damaging Het
Or5m10 T C 2: 85,717,783 (GRCm39) I213T probably benign Het
Or5p70 G A 7: 107,994,707 (GRCm39) V127I probably benign Het
Pcdhb6 A T 18: 37,467,753 (GRCm39) T225S probably benign Het
Rfng C A 11: 120,672,842 (GRCm39) V294L probably benign Het
Scml4 C T 10: 42,741,566 (GRCm39) probably benign Het
Slc5a2 A G 7: 127,869,787 (GRCm39) I407V possibly damaging Het
Strc T C 2: 121,201,295 (GRCm39) T1267A probably benign Het
Tanc1 T C 2: 59,626,341 (GRCm39) V566A probably damaging Het
Tas1r2 T C 4: 139,394,647 (GRCm39) S468P probably damaging Het
Tenm2 T A 11: 35,914,626 (GRCm39) T2304S probably benign Het
Tirap A T 9: 35,100,054 (GRCm39) L210Q probably damaging Het
Vav3 A T 3: 109,248,557 (GRCm39) Q68L probably benign Het
Vmn2r54 C T 7: 12,363,594 (GRCm39) S433N probably benign Het
Wars1 A T 12: 108,841,047 (GRCm39) Y244N probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTACAGGGATTATGATGTTCC -3'
(R):5'- ATGAATGCCCTTGGACACTC -3'

Sequencing Primer
(F):5'- CAGGGATTATGATGTTCCATTTTCTC -3'
(R):5'- TCTATGGAAAACAGCCTGGAGTTCC -3'
Posted On 2017-01-03