Incidental Mutation 'R5703:Gbp6'
ID451789
Institutional Source Beutler Lab
Gene Symbol Gbp6
Ensembl Gene ENSMUSG00000104713
Gene Nameguanylate binding protein 6
SynonymsMpa2l
MMRRC Submission 043183-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5703 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105270702-105293698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105273281 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 553 (K553E)
Ref Sequence ENSEMBL: ENSMUSP00000142518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196520
AA Change: K553E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: K553E

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199944
Predicted Effect probably benign
Transcript: ENSMUST00000200045
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,420,559 N605I probably damaging Het
AI314180 A T 4: 58,877,171 probably null Het
Btd C T 14: 31,667,047 R242* probably null Het
Cdc42bpg A G 19: 6,322,673 D1502G possibly damaging Het
Chst2 A G 9: 95,404,932 F454L probably damaging Het
Col16a1 G A 4: 130,053,299 A146T probably damaging Het
Cyp3a11 A T 5: 145,860,373 S399T probably benign Het
Dspp C T 5: 104,177,051 H427Y possibly damaging Het
Dtx4 A T 19: 12,482,210 M410K possibly damaging Het
Epb41l2 C T 10: 25,441,767 R61W probably damaging Het
Fam126a A T 5: 23,980,579 probably null Het
Git1 CCG C 11: 77,504,668 probably null Het
Gm13199 C T 2: 5,862,448 probably benign Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
Hoxa2 G T 6: 52,163,263 Q248K probably damaging Het
Krt33b T C 11: 100,025,548 T228A probably benign Het
Loxhd1 A G 18: 77,356,877 E324G probably damaging Het
Map3k20 A G 2: 72,402,170 N390S probably benign Het
Mroh7 A G 4: 106,708,560 Y126H possibly damaging Het
Muc4 G A 16: 32,736,241 W15* probably null Het
Ndrg2 T A 14: 51,910,122 probably null Het
Ntsr1 T C 2: 180,500,433 S6P probably damaging Het
Olfr1023 T C 2: 85,887,439 I213T probably benign Het
Olfr495 G A 7: 108,395,500 V127I probably benign Het
Pcdhb6 A T 18: 37,334,700 T225S probably benign Het
Rfng C A 11: 120,782,016 V294L probably benign Het
Scml4 C T 10: 42,865,570 probably benign Het
Slc5a2 A G 7: 128,270,615 I407V possibly damaging Het
Strc T C 2: 121,370,814 T1267A probably benign Het
Tanc1 T C 2: 59,795,997 V566A probably damaging Het
Tas1r2 T C 4: 139,667,336 S468P probably damaging Het
Tenm2 T A 11: 36,023,799 T2304S probably benign Het
Tirap A T 9: 35,188,758 L210Q probably damaging Het
Vav3 A T 3: 109,341,241 Q68L probably benign Het
Vmn2r54 C T 7: 12,629,667 S433N probably benign Het
Wars A T 12: 108,875,121 Y244N probably damaging Het
Zc3h6 A G 2: 128,993,452 probably benign Het
Other mutations in Gbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gbp6 APN 5 105274279 nonsense probably null
IGL01721:Gbp6 APN 5 105274207 missense probably benign 0.01
IGL02310:Gbp6 APN 5 105290975 missense probably benign 0.00
IGL02432:Gbp6 APN 5 105274362 missense probably benign
R7834:Gbp6 UTSW 5 105273265 missense probably benign 0.41
R7917:Gbp6 UTSW 5 105273265 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGGCTAACATTGTCTTTGCAGG -3'
(R):5'- ACCCTACTTCCTCATAATGTGTAGG -3'

Sequencing Primer
(F):5'- GTCTTTGCAGGCATGTATGAAAC -3'
(R):5'- ACTTCCTCATAATGTGTAGGTCTATC -3'
Posted On2017-01-03