Incidental Mutation 'R5703:Rfng'
ID451806
Institutional Source Beutler Lab
Gene Symbol Rfng
Ensembl Gene ENSMUSG00000025158
Gene NameRFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsradical fringe
MMRRC Submission 043183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5703 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120780746-120784207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120782016 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 294 (V294L)
Ref Sequence ENSEMBL: ENSMUSP00000026156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026156] [ENSMUST00000100134] [ENSMUST00000116305] [ENSMUST00000153678] [ENSMUST00000172809] [ENSMUST00000208737]
Predicted Effect probably benign
Transcript: ENSMUST00000026156
AA Change: V294L

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026156
Gene: ENSMUSG00000025158
AA Change: V294L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 54 306 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100134
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116305
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144519
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect probably benign
Transcript: ENSMUST00000172809
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display a completely normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,420,559 N605I probably damaging Het
AI314180 A T 4: 58,877,171 probably null Het
Btd C T 14: 31,667,047 R242* probably null Het
Cdc42bpg A G 19: 6,322,673 D1502G possibly damaging Het
Chst2 A G 9: 95,404,932 F454L probably damaging Het
Col16a1 G A 4: 130,053,299 A146T probably damaging Het
Cyp3a11 A T 5: 145,860,373 S399T probably benign Het
Dspp C T 5: 104,177,051 H427Y possibly damaging Het
Dtx4 A T 19: 12,482,210 M410K possibly damaging Het
Epb41l2 C T 10: 25,441,767 R61W probably damaging Het
Fam126a A T 5: 23,980,579 probably null Het
Gbp6 T C 5: 105,273,281 K553E probably benign Het
Git1 CCG C 11: 77,504,668 probably null Het
Gm13199 C T 2: 5,862,448 probably benign Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
Hoxa2 G T 6: 52,163,263 Q248K probably damaging Het
Krt33b T C 11: 100,025,548 T228A probably benign Het
Loxhd1 A G 18: 77,356,877 E324G probably damaging Het
Map3k20 A G 2: 72,402,170 N390S probably benign Het
Mroh7 A G 4: 106,708,560 Y126H possibly damaging Het
Muc4 G A 16: 32,736,241 W15* probably null Het
Ndrg2 T A 14: 51,910,122 probably null Het
Ntsr1 T C 2: 180,500,433 S6P probably damaging Het
Olfr1023 T C 2: 85,887,439 I213T probably benign Het
Olfr495 G A 7: 108,395,500 V127I probably benign Het
Pcdhb6 A T 18: 37,334,700 T225S probably benign Het
Scml4 C T 10: 42,865,570 probably benign Het
Slc5a2 A G 7: 128,270,615 I407V possibly damaging Het
Strc T C 2: 121,370,814 T1267A probably benign Het
Tanc1 T C 2: 59,795,997 V566A probably damaging Het
Tas1r2 T C 4: 139,667,336 S468P probably damaging Het
Tenm2 T A 11: 36,023,799 T2304S probably benign Het
Tirap A T 9: 35,188,758 L210Q probably damaging Het
Vav3 A T 3: 109,341,241 Q68L probably benign Het
Vmn2r54 C T 7: 12,629,667 S433N probably benign Het
Wars A T 12: 108,875,121 Y244N probably damaging Het
Zc3h6 A G 2: 128,993,452 probably benign Het
Other mutations in Rfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Rfng APN 11 120783952 missense probably damaging 0.99
IGL01073:Rfng APN 11 120783921 missense probably benign 0.01
IGL01748:Rfng APN 11 120783743 missense probably benign 0.00
R1533:Rfng UTSW 11 120781861 nonsense probably null
R2697:Rfng UTSW 11 120784039 unclassified probably benign
R4169:Rfng UTSW 11 120783946 missense probably benign 0.10
R4401:Rfng UTSW 11 120782480 missense possibly damaging 0.94
R4613:Rfng UTSW 11 120782650 missense probably damaging 1.00
R4738:Rfng UTSW 11 120783964 missense probably damaging 1.00
R5015:Rfng UTSW 11 120783050 missense probably damaging 0.98
R6191:Rfng UTSW 11 120782690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTCTTCATAGGACACCAGTG -3'
(R):5'- ACTTTGCCTGCTGGATGGAG -3'

Sequencing Primer
(F):5'- CAGTGGGTGTCTGGGTAGAGAAG -3'
(R):5'- CTGCTGGATGGAGAACCTTCAG -3'
Posted On2017-01-03