Incidental Mutation 'R5703:Dtx4'
ID 451815
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 043183-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R5703 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12482210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 410 (M410K)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect possibly damaging
Transcript: ENSMUST00000045521
AA Change: M410K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: M410K

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,420,559 N605I probably damaging Het
AI314180 A T 4: 58,877,171 probably null Het
Btd C T 14: 31,667,047 R242* probably null Het
Cdc42bpg A G 19: 6,322,673 D1502G possibly damaging Het
Chst2 A G 9: 95,404,932 F454L probably damaging Het
Col16a1 G A 4: 130,053,299 A146T probably damaging Het
Cyp3a11 A T 5: 145,860,373 S399T probably benign Het
Dspp C T 5: 104,177,051 H427Y possibly damaging Het
Epb41l2 C T 10: 25,441,767 R61W probably damaging Het
Fam126a A T 5: 23,980,579 probably null Het
Gbp6 T C 5: 105,273,281 K553E probably benign Het
Git1 CCG C 11: 77,504,668 probably null Het
Gm13199 C T 2: 5,862,448 probably benign Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
Hoxa2 G T 6: 52,163,263 Q248K probably damaging Het
Krt33b T C 11: 100,025,548 T228A probably benign Het
Loxhd1 A G 18: 77,356,877 E324G probably damaging Het
Map3k20 A G 2: 72,402,170 N390S probably benign Het
Mroh7 A G 4: 106,708,560 Y126H possibly damaging Het
Muc4 G A 16: 32,736,241 W15* probably null Het
Ndrg2 T A 14: 51,910,122 probably null Het
Ntsr1 T C 2: 180,500,433 S6P probably damaging Het
Olfr1023 T C 2: 85,887,439 I213T probably benign Het
Olfr495 G A 7: 108,395,500 V127I probably benign Het
Pcdhb6 A T 18: 37,334,700 T225S probably benign Het
Rfng C A 11: 120,782,016 V294L probably benign Het
Scml4 C T 10: 42,865,570 probably benign Het
Slc5a2 A G 7: 128,270,615 I407V possibly damaging Het
Strc T C 2: 121,370,814 T1267A probably benign Het
Tanc1 T C 2: 59,795,997 V566A probably damaging Het
Tas1r2 T C 4: 139,667,336 S468P probably damaging Het
Tenm2 T A 11: 36,023,799 T2304S probably benign Het
Tirap A T 9: 35,188,758 L210Q probably damaging Het
Vav3 A T 3: 109,341,241 Q68L probably benign Het
Vmn2r54 C T 7: 12,629,667 S433N probably benign Het
Wars A T 12: 108,875,121 Y244N probably damaging Het
Zc3h6 A G 2: 128,993,452 probably benign Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGAGTTCCAACAACGTGTG -3'
(R):5'- GCTAGCCTGTATGCATGTATGG -3'

Sequencing Primer
(F):5'- GGAACCAGTCATGACCTCAC -3'
(R):5'- GGGAATTATTTGAGGAATATCTCTGC -3'
Posted On 2017-01-03