Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:G3bp1'

45182

Institutional Source

Beutler Lab

Gene Symbol

G3bp1

Ensembl Gene

ENSMUSG00000018583

Gene Name

GTPase activating protein (SH3 domain) binding protein 1

Synonyms

GAP SH3 binding protein

MMRRC Submission

038743-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55469685-55504838 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55489143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 101 (N101S)

Ref Sequence

ENSEMBL: ENSMUSP00000018727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018727]

AlphaFold

P97855

Predicted Effect

probably benign
Transcript: ENSMUST00000018727
AA Change: N101S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: N101S

Domain	Start	End	E-Value	Type
Pfam:NTF2	11	133	5.8e-35	PFAM
low complexity region	142	167	N/A	INTRINSIC
low complexity region	187	206	N/A	INTRINSIC
low complexity region	211	225	N/A	INTRINSIC
low complexity region	289	305	N/A	INTRINSIC
RRM	339	409	1.49e-13	SMART
low complexity region	419	447	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151790

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in G3bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02231:G3bp1	APN	11	55495447	nonsense	probably null
silverheels	UTSW	11	55489116	missense	possibly damaging	0.95
R0056:G3bp1	UTSW	11	55498041	missense	probably benign	0.03
R0113:G3bp1	UTSW	11	55495426	missense	probably benign	0.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0311:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0312:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0367:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0368:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0454:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0464:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0465:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0466:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0467:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0486:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0487:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0533:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0689:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0848:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R2109:G3bp1	UTSW	11	55489160	missense	probably damaging	0.97
R5129:G3bp1	UTSW	11	55489116	missense	possibly damaging	0.95
R5439:G3bp1	UTSW	11	55497987	missense	probably damaging	0.96
R5834:G3bp1	UTSW	11	55497940	missense	probably benign
R6692:G3bp1	UTSW	11	55493509	missense	probably benign	0.00
R6925:G3bp1	UTSW	11	55497960	missense	possibly damaging	0.47
R7091:G3bp1	UTSW	11	55496221	missense	possibly damaging	0.94
R8348:G3bp1	UTSW	11	55498631	missense	possibly damaging	0.81
R9375:G3bp1	UTSW	11	55499613	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTTGGAGACTGCTCAACCAC -3'
(R):5'- CACCACAGCTTTAGGACAAGAGGAC -3'

Sequencing Primer
(F):5'- GCTGAGTGTCAAGTACACATCTG -3'
(R):5'- GAGGACAGAGCAGCTCTACC -3'

Posted On

2013-06-11