Incidental Mutation 'R5704:Abcg3'
ID451837
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene NameATP binding cassette subfamily G member 3
SynonymsMxr2, Abcp2
MMRRC Submission 043329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5704 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104935057-104982718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104968170 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 266 (A266V)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: A266V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: A266V

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130644
AA Change: A266V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: A266V

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197004
Meta Mutation Damage Score 0.1273 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,631,543 S617P probably benign Het
Ahi1 A C 10: 21,074,427 M126L probably benign Het
Alk T C 17: 72,603,120 E197G probably damaging Het
Alyref2 A T 1: 171,503,979 Y108F probably damaging Het
Ankrd26 T G 6: 118,523,882 H876P probably damaging Het
Arfgef1 T C 1: 10,159,583 T1298A probably damaging Het
Arhgap33 T A 7: 30,519,620 probably benign Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
Arid1a A T 4: 133,681,739 V1819E unknown Het
Asprv1 A G 6: 86,628,550 N126S probably damaging Het
Atg16l2 T C 7: 101,300,211 Y43C probably damaging Het
Atp13a3 G T 16: 30,321,879 T1160K probably benign Het
Atp1a3 T C 7: 24,997,311 T272A probably damaging Het
Bpifa3 G T 2: 154,137,642 probably null Het
Bri3 T C 5: 144,255,906 V80A probably damaging Het
Ccdc28a T A 10: 18,230,572 E2V probably damaging Het
Ccdc7a T A 8: 128,980,096 probably benign Het
Cds2 G A 2: 132,293,329 V47I probably benign Het
Cela2a G A 4: 141,825,988 probably benign Het
Ckap5 A G 2: 91,576,203 Y783C probably damaging Het
Cmtr1 G C 17: 29,663,243 A23P possibly damaging Het
Crym C A 7: 120,201,940 probably null Het
Def6 T G 17: 28,228,226 D610E probably benign Het
Dnajc15 T C 14: 77,826,458 Y130C probably damaging Het
Dock8 G A 19: 25,174,222 V1560I probably damaging Het
Eif4g3 T C 4: 138,190,692 V1501A probably damaging Het
Esyt1 A G 10: 128,511,510 S1049P probably damaging Het
Gm4952 G T 19: 12,626,911 R229L probably damaging Het
Gm5724 T C 6: 141,713,254 M539V probably benign Het
Golga5 T A 12: 102,489,448 H548Q probably benign Het
Gspt1 A T 16: 11,228,193 D449E possibly damaging Het
Gtf3c2 T A 5: 31,159,110 D732V probably damaging Het
Hax1 T A 3: 89,996,096 Q168L probably damaging Het
Hectd2 T A 19: 36,598,891 S91T possibly damaging Het
Igfbp2 T A 1: 72,852,144 H300Q probably benign Het
Il12rb2 T C 6: 67,292,213 N538S possibly damaging Het
Insr G A 8: 3,185,122 P124L possibly damaging Het
Irak3 C A 10: 120,145,689 R437L probably benign Het
Jhy C T 9: 40,897,438 V676I probably damaging Het
Kcns3 G A 12: 11,092,327 R124C probably benign Het
Lactb G A 9: 66,955,776 R519* probably null Het
Mdfic G A 6: 15,770,292 G94D probably damaging Het
Mospd3 A G 5: 137,600,351 V42A possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mucl1 T C 15: 103,755,397 I15V probably benign Het
Mug1 T A 6: 121,851,433 V268D possibly damaging Het
Myo5c T A 9: 75,272,903 S709T probably benign Het
Nol11 T A 11: 107,173,369 E519V probably benign Het
Nrp2 A T 1: 62,785,108 I791L probably benign Het
Nudt19 A G 7: 35,551,547 Y256H probably benign Het
Nudt8 C T 19: 4,000,777 R42C probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr806 T A 10: 129,738,816 I34F probably benign Het
Pcdhga12 A G 18: 37,767,369 Y418C probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Pdzd2 T C 15: 12,385,675 D1003G probably benign Het
Pglyrp4 T A 3: 90,740,274 probably null Het
Phip T C 9: 82,871,355 N1779D probably damaging Het
Postn G T 3: 54,372,106 C335F probably damaging Het
Ppp4r3a T C 12: 101,083,360 probably benign Het
Prrt2 C T 7: 127,019,418 V292M probably damaging Het
Rpl18 T C 7: 45,720,722 V138A possibly damaging Het
Rps14 G A 18: 60,777,133 probably benign Het
Sbno1 A G 5: 124,395,893 probably null Het
Siah2 T G 3: 58,676,400 K155T probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc25a39 T A 11: 102,403,394 probably benign Het
Smok2b T A 17: 13,236,344 C464S probably damaging Het
Spata31 G A 13: 64,922,041 V668I probably benign Het
Tbxas1 C A 6: 39,021,133 H212N probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Thada C T 17: 84,230,901 A1560T probably benign Het
Tmem241 G C 18: 12,064,206 F65L probably damaging Het
Ttc16 C G 2: 32,769,125 E321Q probably damaging Het
Ttn A T 2: 76,918,585 L4040H possibly damaging Het
Tyw1 G A 5: 130,282,022 W437* probably null Het
Unc79 T A 12: 103,001,943 Y143N probably damaging Het
Urb2 C T 8: 124,038,182 R1310W probably damaging Het
Vmn2r4 T C 3: 64,409,949 I34V probably benign Het
Zfp513 C T 5: 31,200,666 C121Y possibly damaging Het
Zfp606 T G 7: 12,493,529 W468G probably damaging Het
Zfyve16 C T 13: 92,504,471 probably null Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4242:Abcg3 UTSW 5 104961213 missense probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5309:Abcg3 UTSW 5 104936599 missense possibly damaging 0.53
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6309:Abcg3 UTSW 5 104969393 critical splice donor site probably null
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6872:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
R7531:Abcg3 UTSW 5 104977641 missense probably benign
R7685:Abcg3 UTSW 5 104968215 missense probably damaging 1.00
R7728:Abcg3 UTSW 5 104936078 missense probably benign 0.00
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGGATAAGGGCCCTG -3'
(R):5'- CAAGGTTCTGGTGTCCTGTGAC -3'

Sequencing Primer
(F):5'- TGTTAAACTAACAAAACTCCTGTCC -3'
(R):5'- GTGACTCCACATGTCTCCC -3'
Posted On2017-01-03