Incidental Mutation 'R5704:Acad10'
ID 451838
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Name acyl-Coenzyme A dehydrogenase family, member 10
Synonyms 2410021P16Rik
MMRRC Submission 043329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5704 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 121621026-121660514 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121631543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 617 (S617P)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
AlphaFold Q8K370
Predicted Effect probably benign
Transcript: ENSMUST00000031412
AA Change: S617P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: S617P

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111770
AA Change: S617P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: S617P

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143187
Meta Mutation Damage Score 0.1102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ahi1 A C 10: 21,074,427 M126L probably benign Het
Alk T C 17: 72,603,120 E197G probably damaging Het
Alyref2 A T 1: 171,503,979 Y108F probably damaging Het
Ankrd26 T G 6: 118,523,882 H876P probably damaging Het
Arfgef1 T C 1: 10,159,583 T1298A probably damaging Het
Arhgap33 T A 7: 30,519,620 probably benign Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
Arid1a A T 4: 133,681,739 V1819E unknown Het
Asprv1 A G 6: 86,628,550 N126S probably damaging Het
Atg16l2 T C 7: 101,300,211 Y43C probably damaging Het
Atp13a3 G T 16: 30,321,879 T1160K probably benign Het
Atp1a3 T C 7: 24,997,311 T272A probably damaging Het
Bpifa3 G T 2: 154,137,642 probably null Het
Bri3 T C 5: 144,255,906 V80A probably damaging Het
Ccdc28a T A 10: 18,230,572 E2V probably damaging Het
Ccdc7a T A 8: 128,980,096 probably benign Het
Cds2 G A 2: 132,293,329 V47I probably benign Het
Cela2a G A 4: 141,825,988 probably benign Het
Ckap5 A G 2: 91,576,203 Y783C probably damaging Het
Cmtr1 G C 17: 29,663,243 A23P possibly damaging Het
Crym C A 7: 120,201,940 probably null Het
Def6 T G 17: 28,228,226 D610E probably benign Het
Dnajc15 T C 14: 77,826,458 Y130C probably damaging Het
Dock8 G A 19: 25,174,222 V1560I probably damaging Het
Eif4g3 T C 4: 138,190,692 V1501A probably damaging Het
Esyt1 A G 10: 128,511,510 S1049P probably damaging Het
Gm4952 G T 19: 12,626,911 R229L probably damaging Het
Gm5724 T C 6: 141,713,254 M539V probably benign Het
Golga5 T A 12: 102,489,448 H548Q probably benign Het
Gspt1 A T 16: 11,228,193 D449E possibly damaging Het
Gtf3c2 T A 5: 31,159,110 D732V probably damaging Het
Hax1 T A 3: 89,996,096 Q168L probably damaging Het
Hectd2 T A 19: 36,598,891 S91T possibly damaging Het
Igfbp2 T A 1: 72,852,144 H300Q probably benign Het
Il12rb2 T C 6: 67,292,213 N538S possibly damaging Het
Insr G A 8: 3,185,122 P124L possibly damaging Het
Irak3 C A 10: 120,145,689 R437L probably benign Het
Jhy C T 9: 40,897,438 V676I probably damaging Het
Kcns3 G A 12: 11,092,327 R124C probably benign Het
Lactb G A 9: 66,955,776 R519* probably null Het
Mdfic G A 6: 15,770,292 G94D probably damaging Het
Mospd3 A G 5: 137,600,351 V42A possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mucl1 T C 15: 103,755,397 I15V probably benign Het
Mug1 T A 6: 121,851,433 V268D possibly damaging Het
Myo5c T A 9: 75,272,903 S709T probably benign Het
Nol11 T A 11: 107,173,369 E519V probably benign Het
Nrp2 A T 1: 62,785,108 I791L probably benign Het
Nudt19 A G 7: 35,551,547 Y256H probably benign Het
Nudt8 C T 19: 4,000,777 R42C probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr806 T A 10: 129,738,816 I34F probably benign Het
Pcdhga12 A G 18: 37,767,369 Y418C probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Pdzd2 T C 15: 12,385,675 D1003G probably benign Het
Pglyrp4 T A 3: 90,740,274 probably null Het
Phip T C 9: 82,871,355 N1779D probably damaging Het
Postn G T 3: 54,372,106 C335F probably damaging Het
Ppp4r3a T C 12: 101,083,360 probably benign Het
Prrt2 C T 7: 127,019,418 V292M probably damaging Het
Rpl18 T C 7: 45,720,722 V138A possibly damaging Het
Rps14 G A 18: 60,777,133 probably benign Het
Sbno1 A G 5: 124,395,893 probably null Het
Siah2 T G 3: 58,676,400 K155T probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc25a39 T A 11: 102,403,394 probably benign Het
Smok2b T A 17: 13,236,344 C464S probably damaging Het
Spata31 G A 13: 64,922,041 V668I probably benign Het
Tbxas1 C A 6: 39,021,133 H212N probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Thada C T 17: 84,230,901 A1560T probably benign Het
Tmem241 G C 18: 12,064,206 F65L probably damaging Het
Ttc16 C G 2: 32,769,125 E321Q probably damaging Het
Ttn A T 2: 76,918,585 L4040H possibly damaging Het
Tyw1 G A 5: 130,282,022 W437* probably null Het
Unc79 T A 12: 103,001,943 Y143N probably damaging Het
Urb2 C T 8: 124,038,182 R1310W probably damaging Het
Vmn2r4 T C 3: 64,409,949 I34V probably benign Het
Zfp513 C T 5: 31,200,666 C121Y possibly damaging Het
Zfp606 T G 7: 12,493,529 W468G probably damaging Het
Zfyve16 C T 13: 92,504,471 probably null Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1052:Acad10 UTSW 5 121649541 missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3824:Acad10 UTSW 5 121622818 missense probably benign
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6384:Acad10 UTSW 5 121652003 missense probably benign 0.43
R6491:Acad10 UTSW 5 121630157 missense probably damaging 1.00
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
R8400:Acad10 UTSW 5 121626205 missense possibly damaging 0.82
R9171:Acad10 UTSW 5 121629918 missense probably benign 0.14
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTATCAGCGGGGAAGG -3'
(R):5'- TGTCACTGACTCACACATCC -3'

Sequencing Primer
(F):5'- GGGGGTACACCTTCTGTTCTATAAAC -3'
(R):5'- ACACATCCCCAGGGTGGTTATG -3'
Posted On 2017-01-03