Incidental Mutation 'R5704:Il12rb2'
ID451845
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 043329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5704 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67292213 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 538 (N538S)
Ref Sequence ENSEMBL: ENSMUSP00000113267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000042990] [ENSMUST00000117441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018485
AA Change: N872S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: N872S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042990
SMART Domains Protein: ENSMUSP00000039110
Gene: ENSMUSG00000036371

DomainStartEndE-ValueType
Pfam:IHABP4_N 5 152 7.4e-42 PFAM
HABP4_PAI-RBP1 189 313 2.73e-44 SMART
low complexity region 362 384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117441
AA Change: N538S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341
AA Change: N538S

DomainStartEndE-ValueType
Blast:FN3 6 100 1e-41 BLAST
FN3 102 191 3.17e-4 SMART
FN3 200 288 6.45e-5 SMART
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Acad10 A G 5: 121,631,543 S617P probably benign Het
Ahi1 A C 10: 21,074,427 M126L probably benign Het
Alk T C 17: 72,603,120 E197G probably damaging Het
Alyref2 A T 1: 171,503,979 Y108F probably damaging Het
Ankrd26 T G 6: 118,523,882 H876P probably damaging Het
Arfgef1 T C 1: 10,159,583 T1298A probably damaging Het
Arhgap33 T A 7: 30,519,620 probably benign Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
Arid1a A T 4: 133,681,739 V1819E unknown Het
Asprv1 A G 6: 86,628,550 N126S probably damaging Het
Atg16l2 T C 7: 101,300,211 Y43C probably damaging Het
Atp13a3 G T 16: 30,321,879 T1160K probably benign Het
Atp1a3 T C 7: 24,997,311 T272A probably damaging Het
Bpifa3 G T 2: 154,137,642 probably null Het
Bri3 T C 5: 144,255,906 V80A probably damaging Het
Ccdc28a T A 10: 18,230,572 E2V probably damaging Het
Ccdc7a T A 8: 128,980,096 probably benign Het
Cds2 G A 2: 132,293,329 V47I probably benign Het
Cela2a G A 4: 141,825,988 probably benign Het
Ckap5 A G 2: 91,576,203 Y783C probably damaging Het
Cmtr1 G C 17: 29,663,243 A23P possibly damaging Het
Crym C A 7: 120,201,940 probably null Het
Def6 T G 17: 28,228,226 D610E probably benign Het
Dnajc15 T C 14: 77,826,458 Y130C probably damaging Het
Dock8 G A 19: 25,174,222 V1560I probably damaging Het
Eif4g3 T C 4: 138,190,692 V1501A probably damaging Het
Esyt1 A G 10: 128,511,510 S1049P probably damaging Het
Gm4952 G T 19: 12,626,911 R229L probably damaging Het
Gm5724 T C 6: 141,713,254 M539V probably benign Het
Golga5 T A 12: 102,489,448 H548Q probably benign Het
Gspt1 A T 16: 11,228,193 D449E possibly damaging Het
Gtf3c2 T A 5: 31,159,110 D732V probably damaging Het
Hax1 T A 3: 89,996,096 Q168L probably damaging Het
Hectd2 T A 19: 36,598,891 S91T possibly damaging Het
Igfbp2 T A 1: 72,852,144 H300Q probably benign Het
Insr G A 8: 3,185,122 P124L possibly damaging Het
Irak3 C A 10: 120,145,689 R437L probably benign Het
Jhy C T 9: 40,897,438 V676I probably damaging Het
Kcns3 G A 12: 11,092,327 R124C probably benign Het
Lactb G A 9: 66,955,776 R519* probably null Het
Mdfic G A 6: 15,770,292 G94D probably damaging Het
Mospd3 A G 5: 137,600,351 V42A possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mucl1 T C 15: 103,755,397 I15V probably benign Het
Mug1 T A 6: 121,851,433 V268D possibly damaging Het
Myo5c T A 9: 75,272,903 S709T probably benign Het
Nol11 T A 11: 107,173,369 E519V probably benign Het
Nrp2 A T 1: 62,785,108 I791L probably benign Het
Nudt19 A G 7: 35,551,547 Y256H probably benign Het
Nudt8 C T 19: 4,000,777 R42C probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr806 T A 10: 129,738,816 I34F probably benign Het
Pcdhga12 A G 18: 37,767,369 Y418C probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Pdzd2 T C 15: 12,385,675 D1003G probably benign Het
Pglyrp4 T A 3: 90,740,274 probably null Het
Phip T C 9: 82,871,355 N1779D probably damaging Het
Postn G T 3: 54,372,106 C335F probably damaging Het
Ppp4r3a T C 12: 101,083,360 probably benign Het
Prrt2 C T 7: 127,019,418 V292M probably damaging Het
Rpl18 T C 7: 45,720,722 V138A possibly damaging Het
Rps14 G A 18: 60,777,133 probably benign Het
Sbno1 A G 5: 124,395,893 probably null Het
Siah2 T G 3: 58,676,400 K155T probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc25a39 T A 11: 102,403,394 probably benign Het
Smok2b T A 17: 13,236,344 C464S probably damaging Het
Spata31 G A 13: 64,922,041 V668I probably benign Het
Tbxas1 C A 6: 39,021,133 H212N probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Thada C T 17: 84,230,901 A1560T probably benign Het
Tmem241 G C 18: 12,064,206 F65L probably damaging Het
Ttc16 C G 2: 32,769,125 E321Q probably damaging Het
Ttn A T 2: 76,918,585 L4040H possibly damaging Het
Tyw1 G A 5: 130,282,022 W437* probably null Het
Unc79 T A 12: 103,001,943 Y143N probably damaging Het
Urb2 C T 8: 124,038,182 R1310W probably damaging Het
Vmn2r4 T C 3: 64,409,949 I34V probably benign Het
Zfp513 C T 5: 31,200,666 C121Y possibly damaging Het
Zfp606 T G 7: 12,493,529 W468G probably damaging Het
Zfyve16 C T 13: 92,504,471 probably null Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCATGACTATCTTGGGGTCC -3'
(R):5'- AACTACCTTCCTAGCCATGAAGG -3'

Sequencing Primer
(F):5'- ACTATCTTGGGGTCCTTTCTATATG -3'
(R):5'- TGAAGGCTATTTACCCTCCAACATAG -3'
Posted On2017-01-03